Rmu_sc0002724.1_g000011

Plant protein of unknown function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002724.1
OG0000131
Physical Location & Seq
Reverse (-)
64425 .. 65735
1311 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002724.1_g000011.1.cds

Sequence Viewer

Length: 1311 bp
atgcaaggaagcagtcgagaagctccaaatgacatagaaaaccaaaacatttcgttcgaagattcgatgggacaggagctatatcaggtgtctcctgtcagtcgtgtgtctcaatctcgttgtatttatagagttcctcgacgactacgacacgcacgagaagaggcttacacacccaagtcaatttctattggcccacttcatcacggtaaaaaagacttattgcccatggaagaacacaaaaagaggtacctgcaagattttttaggtcgaagcaggctaagtttgaacgattatatgctgaaaataaaggcgcaagaagaaagactgcgcaattgttacatggagacaatcaagtttgatggtaatgacttggcaagaattgttctagtggatgctatattcatcatcgaagtcttactaaggcactatgacgtgaatttggtggatgcaaatgattgcatctttggtaaaccaaggttaatagttgatatattgcctgacctgttgttgcttgaaaatcaattgccattcttcattctcgaagtgcttagcctggagttggagataactcagacgtatccactggtttttctttctcatatcttcttggaaagtacttcagtaatggccatacaaggaacgatggaagaaaatgtggagagactatgttctcatccagaagatgtaaagcatcttcttgatcttctgagaacgttattgatactaccactaatgtcgaaatcagaagctgaaggggcttatcaaaccgtacgtagcatcacagagctacagcaagcaggagttacccttaaagtggcatccagtgaagacatatttagcatacaattcactgatggggttttggaaattccaaagttaaccatatcagatcactcagaggttacttttagaaatatcattgcctatgaacaatgcgaaatttcttcggaagaactatacataggaaattattttgccattatggatagtttcgtgaatacctcaaaggatgtggacttacttgttgactttggtattgttgacaataatctaggtgatagcaaggaggtttctcgtttgattaacggtattggagctggggttacgttcgaccctgatcactttattttctccaccgtttgccaaaacctgaatgagtactgcaattcgaagtggcacagaaggatggcaaacttgagacaaaattatttcaacacaccttggacaactatctctgtcattgcagctggtattcttcttgtgctcactttgattcaaacggtgtcctctgttatctctattgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

436

Amino Acids

49.66

Weight (kDa)

5.04

Isoelectric Point (pI)

46.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000131)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G31980 AT5G11290 AT5G11290
fragaria_vesca FvH4_2g29230 FvH4_2g29230 FvH4_2g29310 FvH4_2g29351 FvH4_2g29352 FvH4_2g29352 FvH4_2g29362 FvH4_2g29370 FvH4_2g29461 FvH4_2g29461 FvH4_2g29461 FvH4_2g29461 FvH4_2g29470 FvH4_2g29490 FvH4_2g29490 FvH4_2g29500 FvH4_2g29500 FvH4_2g29520 FvH4_2g33600 FvH4_3g29960 FvH4_5g20260 FvH4_7g25070
malus_domestica MD00G1144600.v1.1 MD07G1131600.v1.1 MD08G1146300.v1.1 MD08G1146400.v1.1 MD08G1146500.v1.1 MD08G1146600.v1.1 MD15G1035400.v1.1 MD15G1100600.v1.1 MD15G1100700.v1.1 MD15G1101400.v1.1 MD15G1101800.v1.1 MD15G1118600.v1.1 MD15G1119800.v1.1 MD15G1121700.v1.1 MD15G1121800.v1.1 MD15G1122100.v1.1 MD15G1122400.v1.1 MD15G1122700.v1.1 MD15G1123000.v1.1
prunus_persica Prupe.1G474700_v2.0.a1 Prupe.1G474800_v2.0.a1 Prupe.1G475000_v2.0.a1 Prupe.1G475600_v2.0.a1 Prupe.1G476100_v2.0.a1 Prupe.1G476400_v2.0.a1 Prupe.1G476600_v2.0.a1 Prupe.1G476900_v2.0.a1 Prupe.1G477100_v2.0.a1 Prupe.1G477300_v2.0.a1 Prupe.1G477500_v2.0.a1 Prupe.1G477600_v2.0.a1 Prupe.1G477600_v2.0.a1 Prupe.1G477700_v2.0.a1 Prupe.1G477900_v2.0.a1 Prupe.1G478000_v2.0.a1 Prupe.2G074000_v2.0.a1 Prupe.7G095900_v2.0.a1 Prupe.7G095900_v2.0.a1 Prupe.7G095900_v2.0.a1 Prupe.7G096100_v2.0.a1 Prupe.7G096100_v2.0.a1 Prupe.7G096200_v2.0.a1 Prupe.7G096400_v2.0.a1 Prupe.8G015000_v2.0.a1
pyrus_communis pycom08g12340 pycom11g04600 pycom15g09280 pycom15g10770 pycom15g10790 pycom15g11000 pycom15g11040 pycom854g00030 pycom854g00050
rosa_chinensis RchiOBHm_Chr1g0321791 RchiOBHm_Chr3g0452021 RchiOBHm_Chr3g0452031 RchiOBHm_Chr3g0475821 RchiOBHm_Chr4g0410021 RchiOBHm_Chr4g0412191 RchiOBHm_Chr4g0415271 RchiOBHm_Chr6g0244001 RchiOBHm_Chr6g0252301 RchiOBHm_Chr6g0252341 RchiOBHm_Chr6g0267401 RchiOBHm_Chr6g0297251 RchiOBHm_Chr6g0298131 RchiOBHm_Chr6g0298141 RchiOBHm_Chr6g0298151 RchiOBHm_Chr6g0298161 RchiOBHm_Chr6g0298261 RchiOBHm_Chr6g0298271 RchiOBHm_Chr6g0298281 RchiOBHm_Chr6g0298291 RchiOBHm_Chr6g0298311 RchiOBHm_Chr6g0298321 RchiOBHm_Chr6g0298331 RchiOBHm_Chr6g0298341 RchiOBHm_Chr6g0298381 RchiOBHm_Chr6g0302351 RchiOBHm_Chr7g0203021 RchiOBHm_Chr7g0225421
rosa_laevigata RLG00000023811 RLG00000030588
rosa_multiflora Rmu_co8159872.1_g000001 Rmu_co8452635.1_g000001 Rmu_co8477209.1_g000001 Rmu_sc0000365.1_g000079 Rmu_sc0000461.1_g000042 Rmu_sc0000539.1_g000085 Rmu_sc0001358.1_g000006 Rmu_sc0001358.1_g000007 Rmu_sc0001673.1_g000024 Rmu_sc0002691.1_g000007 Rmu_sc0002724.1_g000011 Rmu_sc0003410.1_g000027 Rmu_sc0003420.1_g000007 Rmu_sc0003420.1_g000008 Rmu_sc0003420.1_g000009 Rmu_sc0003420.1_g000010 Rmu_sc0003551.1_g000014 Rmu_sc0004535.1_g000001 Rmu_sc0006252.1_g000006 Rmu_sc0006543.1_g000004 Rmu_sc0006711.1_g000015 Rmu_sc0007115.1_g000004 Rmu_sc0007115.1_g000011 Rmu_sc0007115.1_g000014 Rmu_sc0009317.1_g000003 Rmu_sc0009318.1_g000002 Rmu_sc0009318.1_g000003 Rmu_sc0010099.1_g000008 Rmu_sc0012041.1_g000004 Rmu_sc0013249.1_g000008 Rmu_sc0035583.1_g000001 Rmu_ssc0000004.1_g000024
rosa_roxburghii Rroxscaffold_1G00023390 Rroxscaffold_1G00024930 Rroxscaffold_3G00234420 Rroxscaffold_3G00234430 Rroxscaffold_5G00354530 Rroxscaffold_6G00405820 Rroxscaffold_6G00429190 Rroxscaffold_7G00165840 Rroxscaffold_7G00169700 Rroxscaffold_7G00169730 Rroxscaffold_7G00169740 Rroxscaffold_7G00169770 Rroxscaffold_7G00169780 Rroxscaffold_7G00169790 Rroxscaffold_7G00169800 Rroxscaffold_7G00170710 Rroxscaffold_7G00170720 Rroxscaffold_7G00185780 Rroxscaffold_7G00185800 Rroxscaffold_7G00201380 Rroxscaffold_7G00216170
rosa_rugosa Rorug03G0151700 Rorug03G0151700 Rorug05G0292700 Rorug05G0292800
rosa_samantha Rh1AG047000 Rh2BG283800 Rh2BG283900 Rh3BG041400 Rh3BG231700 Rh3DG227000 Rh4CG170100 Rh4CG170200 Rh4CG204700 Rh6AG020700 Rh6AG021000 Rh6AG381400 Rh6AG381500 Rh6AG389300 Rh6AG390400 Rh6AG390500 Rh6AG390600 Rh6AG390700 Rh6AG391200 Rh6AG391400 Rh7CG233300
rosa_wichuraiana Rw0G004890 Rw2G021490 Rw3G003000 Rw3G018320 Rw3G018340 Rw4G012210 Rw4G013140 Rw4G016490 Rw6G001700 Rw6G001720 Rw6G001730 Rw6G033220 Rw6G033230 Rw6G033990 Rw6G034080 Rw6G034090 Rw6G034100 Rw6G034110 Rw6G034140 Rw6G034180 Rw6G034190 Rw6G034200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 332
Acc36I ACCTGC 1 cut(s) 261
Acc65I GGTACC 1 cut(s) 249
AccB1I GGYRCC 1 cut(s) 249
AclI AACGTT 1 cut(s) 716
AcoI YGGCCR 1 cut(s) 630
AcsI RAATTY 3 cut(s) 439, 870, 942
AcuI CTGAAG 2 cut(s) 606, 774
AfaI GTAC 4 cut(s) 251, 619, 774, 1163
AfiI CCNNNNNNNGG 2 cut(s) 562, 817
AgsI TTSAA 4 cut(s) 289, 518, 1216, 1280
AjiI CACGTC 1 cut(s) 436
AjnI CCWGG 1 cut(s) 555
AluBI AGCT 6 cut(s) 23, 79, 752, 790, 1100, 1250
AluI AGCT 6 cut(s) 23, 79, 752, 790, 1100, 1250
Alw21I GWGCWC 1 cut(s) 1269
Alw26I GTCTC 5 cut(s) 96, 114, 341, 658, 1195
AlwNI CAGNNNCTG 1 cut(s) 752
AoxI GGCC 2 cut(s) 193, 630
ApeKI GCWGC 1 cut(s) 1247
ApoI RAATTY 3 cut(s) 439, 870, 942
Asp718I GGTACC 1 cut(s) 249
AspLEI GCGC 2 cut(s) 316, 333
AspS9I GGNCC 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 1070
AsuII TTCGAA 2 cut(s) 57, 1172
BalI TGGCCA 1 cut(s) 632
BanI GGYRCC 1 cut(s) 249
BarI GAAGNNNNNNTAC 2 cut(s) 681, 713
BauI CACGAG 1 cut(s) 156
BbsI GAAGAC 1 cut(s) 837
Bbv12I GWGCWC 1 cut(s) 1269
BbvI GCAGC 1 cut(s) 1259
BccI CCATC 5 cut(s) 61, 356, 640, 851, 1183
BciT130I CCWGG 1 cut(s) 557
BciVI GTATCC 1 cut(s) 591
BclI TGATCA 1 cut(s) 1120
BcoDI GTCTC 5 cut(s) 96, 114, 341, 658, 1195
BfaI CTAG 2 cut(s) 389, 1055
BfmI CTRYAG 1 cut(s) 791
BfuAI ACCTGC 1 cut(s) 261
BfuI GTATCC 1 cut(s) 591
BisI GCNGC 1 cut(s) 1248
BlpI GCTNAGC 1 cut(s) 551
BlsI GCNGC 1 cut(s) 1249
BmcAI AGTACT 2 cut(s) 619, 1163
Bme1390I CCNGG 1 cut(s) 557
BmgBI CACGTC 1 cut(s) 436
BmgT120I GGNCC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 251
BmrFI CCNGG 1 cut(s) 557
BmsI GCATC 6 cut(s) 385, 439, 471, 703, 789, 830
BpiI GAAGAC 1 cut(s) 837
BpmI CTGGAG 1 cut(s) 578
Bpu1102I GCTNAGC 1 cut(s) 551
Bpu14I TTCGAA 2 cut(s) 57, 1172
BpuEI CTTGAG 1 cut(s) 1219
BsaAI YACGTR 1 cut(s) 776
BsaJI CCNNGG 3 cut(s) 228, 476, 1223
BsaXI ACNNNNNCTCC 2 cut(s) 1089, 1119
Bsc4I CCNNNNNNNGG 2 cut(s) 562, 817
Bse1I ACTGG 2 cut(s) 591, 825
Bse3DI GCAATG 2 cut(s) 921, 1242
BseBI CCWGG 1 cut(s) 557
BseDI CCNNGG 3 cut(s) 228, 476, 1223
BseGI GGATG 6 cut(s) 400, 454, 676, 821, 1018, 1194
BseLI CCNNNNNNNGG 2 cut(s) 562, 817
BseMI GCAATG 2 cut(s) 921, 1242
BseMII CTCAG 3 cut(s) 587, 701, 912
BseNI ACTGG 2 cut(s) 591, 825
BseXI GCAGC 1 cut(s) 1259
BseYI CCCAGC 1 cut(s) 1100
BshFI GGCC 2 cut(s) 195, 632
BshNI GGYRCC 1 cut(s) 249
BsiHKAI GWGCWC 1 cut(s) 1269
BsiWI CGTACG 1 cut(s) 772
BslFI GGGAC 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 562, 817
BsmAI GTCTC 5 cut(s) 96, 114, 341, 658, 1195
BsmFI GGGAC 1 cut(s) 84
BsnI GGCC 2 cut(s) 195, 632
Bsp119I TTCGAA 2 cut(s) 57, 1172
Bsp1286I GDGCHC 1 cut(s) 1269
Bsp143I GATC 3 cut(s) 703, 892, 1120
Bsp1720I GCTNAGC 1 cut(s) 551
Bsp19I CCATGG 1 cut(s) 228
BspANI GGCC 2 cut(s) 195, 632
BspCNI CTCAG 3 cut(s) 586, 702, 911
BspLI GGNNCC 1 cut(s) 251
BspMI ACCTGC 1 cut(s) 261
BspT104I TTCGAA 2 cut(s) 57, 1172
BspT107I GGYRCC 1 cut(s) 249
BsrDI GCAATG 2 cut(s) 921, 1242
BsrI ACTGG 2 cut(s) 591, 825
BssECI CCNNGG 3 cut(s) 228, 476, 1223
BssMI GATC 3 cut(s) 703, 892, 1120
BssSI CACGAG 1 cut(s) 156
BssT1I CCWWGG 3 cut(s) 228, 476, 1223
Bst2BI CACGAG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 557
Bst4CI ACNGT 5 cut(s) 209, 772, 1091, 1141, 1285
Bst6I CTCTTC 1 cut(s) 156
BstBAI YACGTR 1 cut(s) 776
BstBI TTCGAA 2 cut(s) 57, 1172
BstC8I GCNNGC 2 cut(s) 278, 798
BstDEI CTNAG 6 cut(s) 281, 422, 551, 573, 710, 898
BstDSI CCRYGG 1 cut(s) 228
BstF5I GGATG 6 cut(s) 400, 454, 676, 821, 1018, 1194
BstHHI GCGC 2 cut(s) 316, 333
BstKTI GATC 3 cut(s) 706, 895, 1123
BstMAI GTCTC 5 cut(s) 96, 114, 341, 658, 1195
BstMBI GATC 3 cut(s) 703, 892, 1120
BstMWI GCNNNNNNNGC 1 cut(s) 758
BstNI CCWGG 1 cut(s) 557
BstSCI CCNGG 1 cut(s) 555
BstSFI CTRYAG 1 cut(s) 791
BstSNI TACGTA 1 cut(s) 776
BstV1I GCAGC 1 cut(s) 1259
BstV2I GAAGAC 1 cut(s) 837
BsuI GTATCC 1 cut(s) 591
BsuRI GGCC 2 cut(s) 195, 632
BtgI CCRYGG 1 cut(s) 228
BtrI CACGTC 1 cut(s) 436
BtsCI GGATG 6 cut(s) 400, 454, 676, 821, 1018, 1194
BtsIMutI CAGTG 3 cut(s) 584, 832, 852
BveI ACCTGC 1 cut(s) 261
Cac8I GCNNGC 2 cut(s) 278, 798
CaiI CAGNNNCTG 1 cut(s) 752
CfoI GCGC 2 cut(s) 316, 333
Cfr13I GGNCC 1 cut(s) 194
Csp6I GTAC 4 cut(s) 250, 618, 773, 1162
CspCI CAANNNNNGTGG 2 cut(s) 996, 1031
CviAII CATG 2 cut(s) 229, 343
CviQI GTAC 4 cut(s) 250, 618, 773, 1162
DdeI CTNAG 6 cut(s) 281, 422, 551, 573, 710, 898
DpnI GATC 3 cut(s) 705, 894, 1122
DpnII GATC 3 cut(s) 703, 892, 1120
EaeI YGGCCR 1 cut(s) 630
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
Eco105I TACGTA 1 cut(s) 776
Eco130I CCWWGG 3 cut(s) 228, 476, 1223
Eco57I CTGAAG 2 cut(s) 606, 774
EcoRII CCWGG 1 cut(s) 555
EcoT14I CCWWGG 3 cut(s) 228, 476, 1223
ErhI CCWWGG 3 cut(s) 228, 476, 1223
FaeI CATG 2 cut(s) 232, 346
FaqI GGGAC 1 cut(s) 84
FatI CATG 2 cut(s) 228, 342
FbaI TGATCA 1 cut(s) 1120
Fnu4HI GCNGC 1 cut(s) 1248
FokI GGATG 6 cut(s) 407, 461, 663, 808, 1025, 1201
Fsp4HI GCNGC 1 cut(s) 1248
FspBI CTAG 2 cut(s) 389, 1055
FspI TGCGCA 1 cut(s) 332
GlaI GCGC 2 cut(s) 315, 332
GluI GCNGC 1 cut(s) 1248
GsaI CCCAGC 1 cut(s) 1104
GsuI CTGGAG 1 cut(s) 578
HaeIII GGCC 2 cut(s) 195, 632
HhaI GCGC 2 cut(s) 316, 333
Hin1II CATG 2 cut(s) 232, 346
Hin6I GCGC 2 cut(s) 314, 331
HinP1I GCGC 2 cut(s) 314, 331
HincII GTYRAC 3 cut(s) 882, 1030, 1045
HindII GTYRAC 3 cut(s) 882, 1030, 1045
HinfI GANTC 2 cut(s) 62, 1276
HpaI GTTAAC 1 cut(s) 882
HphI GGTGA 1 cut(s) 1070
Hpy166II GTNNAC 5 cut(s) 473, 882, 1018, 1030, 1045
Hpy188I TCNGA 6 cut(s) 576, 711, 748, 892, 901, 952
Hpy188III TCNNGA 5 cut(s) 17, 542, 680, 701, 997
Hpy8I GTNNAC 5 cut(s) 473, 882, 1018, 1030, 1045
Hpy99I CGWCG 1 cut(s) 144
HpyAV CCTTC 2 cut(s) 749, 1179
HpyCH4III ACNGT 5 cut(s) 209, 772, 1091, 1141, 1285
HpyCH4IV ACGT 5 cut(s) 435, 578, 716, 775, 1109
HpyCH4V TGCA 6 cut(s) 4, 256, 452, 462, 1167, 1247
HpyF10VI GCNNNNNNNGC 1 cut(s) 758
HpyF3I CTNAG 6 cut(s) 281, 422, 551, 573, 710, 898
HpySE526I ACGT 5 cut(s) 435, 578, 716, 775, 1109
Hsp92II CATG 2 cut(s) 232, 346
HspAI GCGC 2 cut(s) 314, 331
KpnI GGTACC 1 cut(s) 253
Ksp22I TGATCA 1 cut(s) 1120
KspAI GTTAAC 1 cut(s) 882
Kzo9I GATC 3 cut(s) 703, 892, 1120
LmnI GCTCC 3 cut(s) 28, 76, 1097
Lsp1109I GCAGC 1 cut(s) 1259
LweI GCATC 6 cut(s) 385, 439, 471, 703, 789, 830
MaeI CTAG 2 cut(s) 389, 1055
MaeII ACGT 5 cut(s) 435, 578, 716, 775, 1109
MaeIII GTNAC 4 cut(s) 338, 805, 904, 1105
MalI GATC 3 cut(s) 705, 894, 1122
MboI GATC 3 cut(s) 703, 892, 1120
MfeI CAATTG 2 cut(s) 334, 524
MhlI GDGCHC 1 cut(s) 1269
MlsI TGGCCA 1 cut(s) 632
MluNI TGGCCA 1 cut(s) 632
MmeI TCCRAC 1 cut(s) 543
MnlI CCTC 7 cut(s) 147, 157, 240, 895, 1015, 1063, 1300
Mox20I TGGCCA 1 cut(s) 632
MscI TGGCCA 1 cut(s) 632
MseI TTAA 5 cut(s) 482, 813, 881, 1086, 1309
Msp20I TGGCCA 1 cut(s) 632
MspA1I CMGCKG 1 cut(s) 1250
MspR9I CCNGG 1 cut(s) 557
MunI CAATTG 2 cut(s) 334, 524
MvaI CCWGG 1 cut(s) 557
MwoI GCNNNNNNNGC 1 cut(s) 758
NcoI CCATGG 1 cut(s) 228
NdeII GATC 3 cut(s) 703, 892, 1120
NlaIII CATG 2 cut(s) 232, 346
NlaIV GGNNCC 1 cut(s) 251
NsbI TGCGCA 1 cut(s) 332
NspV TTCGAA 2 cut(s) 57, 1172
PcsI WCGNNNNNNNCGW 2 cut(s) 145, 154
PfeI GAWTC 2 cut(s) 62, 1276
Pfl23II CGTACG 1 cut(s) 772
PkrI GCNGC 1 cut(s) 1249
Ppu21I YACGTR 1 cut(s) 776
Psp1406I AACGTT 1 cut(s) 716
Psp6I CCWGG 1 cut(s) 555
PspFI CCCAGC 1 cut(s) 1100
PspGI CCWGG 1 cut(s) 555
PspLI CGTACG 1 cut(s) 772
PspN4I GGNNCC 1 cut(s) 251
PspPI GGNCC 1 cut(s) 194
PstNI CAGNNNCTG 1 cut(s) 752
PvuII CAGCTG 1 cut(s) 1250
RsaI GTAC 4 cut(s) 251, 619, 774, 1163
RsaNI GTAC 4 cut(s) 250, 618, 773, 1162
SaqAI TTAA 5 cut(s) 482, 813, 881, 1086, 1309
SatI GCNGC 1 cut(s) 1248
Sau3AI GATC 3 cut(s) 703, 892, 1120
Sau96I GGNCC 1 cut(s) 194
ScaI AGTACT 2 cut(s) 619, 1163
ScrFI CCNGG 1 cut(s) 557
SduI GDGCHC 1 cut(s) 1269
SfaNI GCATC 6 cut(s) 385, 439, 471, 703, 789, 830
SfcI CTRYAG 1 cut(s) 791
SfuI TTCGAA 2 cut(s) 57, 1172
SmlI CTYRAG 1 cut(s) 1198
SmoI CTYRAG 1 cut(s) 1198
SnaBI TACGTA 1 cut(s) 776
SspMI CTAG 2 cut(s) 389, 1055
StyD4I CCNGG 1 cut(s) 555
StyI CCWWGG 3 cut(s) 228, 476, 1223
TaaI ACNGT 5 cut(s) 209, 772, 1091, 1141, 1285
TaiI ACGT 5 cut(s) 438, 581, 719, 778, 1112
TatI WGTACW 2 cut(s) 617, 1161
TfiI GAWTC 2 cut(s) 62, 1276
Tru1I TTAA 5 cut(s) 482, 813, 881, 1086, 1309
Tru9I TTAA 5 cut(s) 482, 813, 881, 1086, 1309
TscAI CASTG 3 cut(s) 591, 832, 859
TseI GCWGC 1 cut(s) 1247
TspDTI ATGAA 4 cut(s) 191, 394, 526, 945
TspRI CASTG 3 cut(s) 591, 832, 859
XapI RAATTY 3 cut(s) 439, 870, 942
XspI CTAG 2 cut(s) 389, 1055
ZrmI AGTACT 2 cut(s) 619, 1163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.