RchiOBHm_Chr2g0147471

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0000193
Physical Location & Seq
Reverse (-)
65070030 .. 65070372
343 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51709

Sequence Viewer

Length: 240 bp
ATGTGGGATGTTTCAAGGAAGGCAAAGTGGCATGTTGTGGCTCTGGACCATACAGAGCACTGTGGAGGAAAGAGAGGTGTGATAGAGTATGAACTATGTGACAATGTTACTGACTGTGTATTTTTTTACTATGGCCATCCAACCGAAAGATTTAACCAGAAAGTTGCCAAGTCATGGTGGAGCCATACTCCCAATGGCACAAGGCCTTACACCAATCTGAAAGATCTTTTTGAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

79

Amino Acids

9.35

Weight (kDa)

6.95

Isoelectric Point (pI)

23.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000193)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53940 AT1G53940 AT1G53970 AT1G53970 AT1G53990 AT3G14225 AT3G14225 AT5G40990
fragaria_vesca FvH4_6g34510 FvH4_6g35571 FvH4_6g35571 FvH4_6g35572 FvH4_6g35580 FvH4_6g35580 FvH4_6g35584 FvH4_6g35600 FvH4_6g35610 FvH4_6g35630 FvH4_6g35631
malus_domestica MD00G1137100.v1.1 MD01G1122400.v1.1 MD07G1191900.v1.1 MD09G1174600.v1.1 MD09G1174700.v1.1 MD09G1175100.v1.1 MD17G1151700.v1.1 MD17G1151800.v1.1
prunus_persica Prupe.3G032700_v2.0.a1 Prupe.3G032900_v2.0.a1 Prupe.3G033100_v2.0.a1 Prupe.3G033200_v2.0.a1 Prupe.3G033300_v2.0.a1 Prupe.3G033400_v2.0.a1 Prupe.3G033500_v2.0.a1 Prupe.3G033600_v2.0.a1
pyrus_communis pycom01g14930 pycom09g09170 pycom09g09180 pycom09g09190 pycom09g09220 pycom17g14510
rosa_chinensis RchiOBHm_Chr2g0147161 RchiOBHm_Chr2g0147301 RchiOBHm_Chr2g0147311 RchiOBHm_Chr2g0147391 RchiOBHm_Chr2g0147431 RchiOBHm_Chr2g0147441 RchiOBHm_Chr2g0147471 RchiOBHm_Chr2g0147491 RchiOBHm_Chr2g0147591 RchiOBHm_Chr2g0147911 RchiOBHm_Chr2g0148061 RchiOBHm_Chr4g0407441 RchiOBHm_Chr4g0407471 RchiOBHm_Chr6g0252881 RchiOBHm_Chr7g0228391 RchiOBHm_Chr7g0228411
rosa_laevigata RLG00000001566 RLG00000020247 RLG00000020250 RLG00000020251 RLG00000020252 RLG00000020255 RLG00000020258 RLG00000020261 RLG00000020262 RLG00000020264 RLG00000020293 RLG00000020307 RLG00000030814
rosa_multiflora Rmu_co8112460.1_g000001 Rmu_co8353483.1_g000001 Rmu_co8492209.1_g000001 Rmu_sc0000308.1_g000061 Rmu_sc0000538.1_g000003 Rmu_sc0001159.1_g000017 Rmu_sc0001159.1_g000023 Rmu_sc0001159.1_g000050 Rmu_sc0001880.1_g000011 Rmu_sc0006302.1_g000003 Rmu_sc0008083.1_g000003 Rmu_sc0010661.1_g000002 Rmu_sc0017091.1_g000001 Rmu_sc0021146.1_g000001
rosa_roxburghii Rroxscaffold_2G00099470 Rroxscaffold_2G00099500 Rroxscaffold_2G00099530 Rroxscaffold_2G00099590 Rroxscaffold_2G00113160 Rroxscaffold_2G00113180 Rroxscaffold_3G00231150 Rroxscaffold_4G00332370 Rroxscaffold_5G00352070
rosa_rugosa Rorug02G0398800 Rorug02G0399100 Rorug02G0399200 Rorug02G0399300 Rorug02G0400100 Rorug02G0400200 Rorug02G0400300.1 Rorug02G0403000 Rorug05G0546600 Rorug05G0547200 Rorug07G0249100 Rorug07G0249200.1 RorugPtG0001700.1
rosa_samantha Rh1CG003800 Rh2AG456000 Rh2AG456200 Rh2AG456400 Rh2AG456500 Rh2AG456900 Rh2AG457200 Rh2AG457500 Rh2AG457600 Rh2AG457700 Rh2AG460000 Rh2AG460400 Rh2BG468900 Rh2BG469000 Rh2BG469800 Rh2BG469900 Rh2BG470000 Rh2BG473300 Rh2BG473800 Rh2CG443400 Rh2CG443800 Rh2CG443900 Rh2CG444400 Rh2CG444600 Rh2CG445000 Rh2CG445100 Rh2CG447300 Rh2CG447600 Rh2DG478200 Rh2DG478300 Rh2DG479300 Rh2DG479500 Rh2DG482200 Rh4AG048300 Rh4CG051600 Rh4CG051700 Rh4CG151200 Rh7AG401800 Rh7CG420700 Rh7DG397900
rosa_wichuraiana Rw2G037300 Rw2G037330 Rw2G037350 Rw2G037360 Rw2G037390 Rw2G037410 Rw2G037620 Rw4G003830 Rw6G005020 Rw6G005580 Rw7G033400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 174
AcoI YGGCCR 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 174
AgsI TTSAA 2 cut(s) 15, 233
Alw21I GWGCWC 1 cut(s) 60
AoxI GGCC 2 cut(s) 133, 203
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BalI TGGCCA 1 cut(s) 135
Bbv12I GWGCWC 1 cut(s) 60
BccI CCATC 1 cut(s) 144
BglII AGATCT 1 cut(s) 223
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 182
BplI GAGNNNNNCTC 2 cut(s) 172, 204
Bsc4I CCNNNNNNNGG 1 cut(s) 174
BseGI GGATG 2 cut(s) 13, 136
BseLI CCNNNNNNNGG 1 cut(s) 174
BshFI GGCC 2 cut(s) 135, 205
BsiHKAI GWGCWC 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 174
BsnI GGCC 2 cut(s) 135, 205
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 1 cut(s) 223
BspANI GGCC 2 cut(s) 135, 205
BspLI GGNNCC 1 cut(s) 182
BssMI GATC 1 cut(s) 223
Bst4CI ACNGT 2 cut(s) 62, 116
BstF5I GGATG 2 cut(s) 13, 136
BstKTI GATC 1 cut(s) 226
BstMBI GATC 1 cut(s) 223
BstNSI RCATGY 1 cut(s) 35
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
BsuRI GGCC 2 cut(s) 135, 205
BtsCI GGATG 2 cut(s) 13, 136
BtsIMutI CAGTG 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 46
CviAII CATG 2 cut(s) 32, 174
CviJI RGCY 4 cut(s) 41, 135, 183, 205
CviKI_1 RGCY 4 cut(s) 41, 135, 183, 205
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
EaeI YGGCCR 1 cut(s) 133
Eco147I AGGCCT 1 cut(s) 205
Eco47I GGWCC 1 cut(s) 46
FaeI CATG 2 cut(s) 35, 177
FaiI YATR 7 cut(s) 33, 51, 90, 97, 132, 175, 186
FatI CATG 2 cut(s) 31, 173
FokI GGATG 2 cut(s) 20, 123
HaeIII GGCC 2 cut(s) 135, 205
Hin1II CATG 2 cut(s) 35, 177
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 13
HpyCH4III ACNGT 2 cut(s) 62, 116
Hsp92II CATG 2 cut(s) 35, 177
Kzo9I GATC 1 cut(s) 223
LmnI GCTCC 1 cut(s) 180
LpnPI CCDG 2 cut(s) 29, 170
MaeIII GTNAC 2 cut(s) 98, 106
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MflI RGATCY 1 cut(s) 223
MhlI GDGCHC 1 cut(s) 60
MlsI TGGCCA 1 cut(s) 135
MluNI TGGCCA 1 cut(s) 135
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 2 cut(s) 59, 68
Mox20I TGGCCA 1 cut(s) 135
MscI TGGCCA 1 cut(s) 135
MseI TTAA 1 cut(s) 153
Msp20I TGGCCA 1 cut(s) 135
NdeII GATC 1 cut(s) 223
NlaIII CATG 2 cut(s) 35, 177
NlaIV GGNNCC 1 cut(s) 182
NmuCI GTSAC 1 cut(s) 98
NspI RCATGY 1 cut(s) 35
PceI AGGCCT 1 cut(s) 205
PflMI CCANNNNNTGG 1 cut(s) 174
PspN4I GGNNCC 1 cut(s) 182
PspPI GGNCC 1 cut(s) 46
PsuI RGATCY 1 cut(s) 223
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 1 cut(s) 223
Sau96I GGNCC 1 cut(s) 46
SduI GDGCHC 1 cut(s) 60
SetI ASST 1 cut(s) 79
SgeI CNNG 7 cut(s) 27, 44, 56, 169, 181, 186, 213
SinI GGWCC 1 cut(s) 46
SseBI AGGCCT 1 cut(s) 205
StuI AGGCCT 1 cut(s) 205
TaaI ACNGT 2 cut(s) 62, 116
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TscAI CASTG 1 cut(s) 65
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
TspDTI ATGAA 1 cut(s) 105
TspRI CASTG 1 cut(s) 65
Van91I CCANNNNNTGG 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 46
XceI RCATGY 1 cut(s) 35
XcmI CCANNNNNNNNNTGG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.