Rmu_sc0001159.1_g000050

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001159.1
OG0000193
Physical Location & Seq
Forward (+)
212739 .. 216185
3447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001159.1_g000050.1.cds

Sequence Viewer

Length: 1248 bp
atgacatgtgatggatcaaacaaaaagcacaaaggcttggataaagagtcatggaaagcatttattgacgacaacaatctgaaggctggagatggatgcgtgtttaaagtcatggagtgcagcagtacaaaactagtattaagagtccaaatcctccgaggtgacatcccagctgaacttttagagaaggatcaaaaaggtggctgttatggccattctgtgcatcagagaaaacatgcagccttgttcatcttcggggattcactatttgatgttggaaataataactacataaacacttccactaactttcaagcaaatttcttcccatatggggaaaccttcttcggccacccgactggtagggtctccgatggtcgtctaatgacagatatcattgctgaatatgcaaacttgccaatgattccaccatacttacaaccggggttcgacaactatactaatggtgtgaactttgcatctgctggggctggtgctctagctgaaacgtttcaaggatttgtgttggaccttaaaactcaactgggttatttcaaaaatgtggagaagcagttgaggcacagactaggtgaagcagaagctcacacgttgttgtccgaagctgtttacttgattgccatcggaagcggtgattactctttcccattcatagcgaattcaagtttgttcgagtctcactcacatgaagaatatgttggcatggtcacaggaaacctgacaaatgtgatcaaagaaatatacaagaaaggaggaagaaaatttgggattgcaggcatggagcctttgggttgtacaccgggcatgagaacagataaaccaggaaacacaagcacctgtaaagaagaagtaaatgcaatttcaaaactccacaatagagtacttgctaaagtcctcctgaagctgaaaggacagctccaagatttcatatactcgaatccaaatttctaccattacctaaatgacatagttcataatccatcaaaacatggtttcaaggaaggaaagatggcatgctgtggctctggtccatacagaggaattatgagctgcggagggaagcgaggtgtgactgagtatcagttatgtgacaatgttactgactatgtcttttttgattccggccatgcaacggaaagggtataccagaaagtttccaagttatggtggagccatactcctgatgtcacagcacgttacatcaatttgaaagagctattcgaagtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

415

Amino Acids

46.22

Weight (kDa)

7.6

Isoelectric Point (pI)

23.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000193)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53940 AT1G53940 AT1G53970 AT1G53970 AT1G53990 AT3G14225 AT3G14225 AT5G40990
fragaria_vesca FvH4_6g34510 FvH4_6g35571 FvH4_6g35571 FvH4_6g35572 FvH4_6g35580 FvH4_6g35580 FvH4_6g35584 FvH4_6g35600 FvH4_6g35610 FvH4_6g35630 FvH4_6g35631
malus_domestica MD00G1137100.v1.1 MD01G1122400.v1.1 MD07G1191900.v1.1 MD09G1174600.v1.1 MD09G1174700.v1.1 MD09G1175100.v1.1 MD17G1151700.v1.1 MD17G1151800.v1.1
prunus_persica Prupe.3G032700_v2.0.a1 Prupe.3G032900_v2.0.a1 Prupe.3G033100_v2.0.a1 Prupe.3G033200_v2.0.a1 Prupe.3G033300_v2.0.a1 Prupe.3G033400_v2.0.a1 Prupe.3G033500_v2.0.a1 Prupe.3G033600_v2.0.a1
pyrus_communis pycom01g14930 pycom09g09170 pycom09g09180 pycom09g09190 pycom09g09220 pycom17g14510
rosa_chinensis RchiOBHm_Chr2g0147161 RchiOBHm_Chr2g0147301 RchiOBHm_Chr2g0147311 RchiOBHm_Chr2g0147391 RchiOBHm_Chr2g0147431 RchiOBHm_Chr2g0147441 RchiOBHm_Chr2g0147471 RchiOBHm_Chr2g0147491 RchiOBHm_Chr2g0147591 RchiOBHm_Chr2g0147911 RchiOBHm_Chr2g0148061 RchiOBHm_Chr4g0407441 RchiOBHm_Chr4g0407471 RchiOBHm_Chr6g0252881 RchiOBHm_Chr7g0228391 RchiOBHm_Chr7g0228411
rosa_laevigata RLG00000001566 RLG00000020247 RLG00000020250 RLG00000020251 RLG00000020252 RLG00000020255 RLG00000020258 RLG00000020261 RLG00000020262 RLG00000020264 RLG00000020293 RLG00000020307 RLG00000030814
rosa_multiflora Rmu_co8112460.1_g000001 Rmu_co8353483.1_g000001 Rmu_co8492209.1_g000001 Rmu_sc0000308.1_g000061 Rmu_sc0000538.1_g000003 Rmu_sc0001159.1_g000017 Rmu_sc0001159.1_g000023 Rmu_sc0001159.1_g000050 Rmu_sc0001880.1_g000011 Rmu_sc0006302.1_g000003 Rmu_sc0008083.1_g000003 Rmu_sc0010661.1_g000002 Rmu_sc0017091.1_g000001 Rmu_sc0021146.1_g000001
rosa_roxburghii Rroxscaffold_2G00099470 Rroxscaffold_2G00099500 Rroxscaffold_2G00099530 Rroxscaffold_2G00099590 Rroxscaffold_2G00113160 Rroxscaffold_2G00113180 Rroxscaffold_3G00231150 Rroxscaffold_4G00332370 Rroxscaffold_5G00352070
rosa_rugosa Rorug02G0398800 Rorug02G0399100 Rorug02G0399200 Rorug02G0399300 Rorug02G0400100 Rorug02G0400200 Rorug02G0400300.1 Rorug02G0403000 Rorug05G0546600 Rorug05G0547200 Rorug07G0249100 Rorug07G0249200.1 RorugPtG0001700.1
rosa_samantha Rh1CG003800 Rh2AG456000 Rh2AG456200 Rh2AG456400 Rh2AG456500 Rh2AG456900 Rh2AG457200 Rh2AG457500 Rh2AG457600 Rh2AG457700 Rh2AG460000 Rh2AG460400 Rh2BG468900 Rh2BG469000 Rh2BG469800 Rh2BG469900 Rh2BG470000 Rh2BG473300 Rh2BG473800 Rh2CG443400 Rh2CG443800 Rh2CG443900 Rh2CG444400 Rh2CG444600 Rh2CG445000 Rh2CG445100 Rh2CG447300 Rh2CG447600 Rh2DG478200 Rh2DG478300 Rh2DG479300 Rh2DG479500 Rh2DG482200 Rh4AG048300 Rh4CG051600 Rh4CG051700 Rh4CG151200 Rh7AG401800 Rh7CG420700 Rh7DG397900
rosa_wichuraiana Rw2G037300 Rw2G037330 Rw2G037350 Rw2G037360 Rw2G037390 Rw2G037410 Rw2G037620 Rw4G003830 Rw6G005020 Rw6G005580 Rw7G033400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 1182
AccI GTMKAC 1 cut(s) 1161
AciI CCGC 2 cut(s) 648, 1071
AclI AACGTT 1 cut(s) 509
AclWI GGATC 2 cut(s) 22, 198
AcoI YGGCCR 3 cut(s) 211, 349, 1141
AcsI RAATTY 4 cut(s) 319, 676, 779, 961
AcuI CTGAAG 2 cut(s) 101, 938
AfaI GTAC 3 cut(s) 127, 814, 900
AfiI CCNNNNNNNGG 4 cut(s) 334, 1055, 1150, 1182
AflIII ACRYGT 2 cut(s) 5, 606
AgsI TTSAA 7 cut(s) 314, 515, 556, 681, 882, 1015, 1228
AhlI ACTAGT 1 cut(s) 133
AjnI CCWGG 1 cut(s) 838
AjuI GAANNNNNNNTTGG 2 cut(s) 699, 731
AluBI AGCT 8 cut(s) 173, 503, 602, 623, 922, 934, 1068, 1234
AluI AGCT 8 cut(s) 173, 503, 602, 623, 922, 934, 1068, 1234
Alw21I GWGCWC 1 cut(s) 499
Alw26I GTCTC 2 cut(s) 373, 699
AlwI GGATC 2 cut(s) 22, 198
AoxI GGCC 3 cut(s) 211, 349, 1141
ApeKI GCWGC 3 cut(s) 120, 239, 1068
ApoI RAATTY 4 cut(s) 319, 676, 779, 961
Asp700I GAANNNNTTC 1 cut(s) 510
AspS9I GGNCC 2 cut(s) 529, 1046
AsuC2I CCSGG 2 cut(s) 444, 819
AsuHPI GGTGA 3 cut(s) 173, 602, 662
AsuII TTCGAA 1 cut(s) 1239
AvaII GGWCC 2 cut(s) 529, 1046
BalI TGGCCA 1 cut(s) 213
Bbv12I GWGCWC 1 cut(s) 499
BbvI GCAGC 3 cut(s) 132, 251, 1055
BccI CCATC 6 cut(s) 5, 86, 368, 647, 1006, 1021
BciT130I CCWGG 1 cut(s) 840
BclI TGATCA 1 cut(s) 747
BcnI CCSGG 2 cut(s) 444, 819
BcoDI GTCTC 2 cut(s) 373, 699
BcuI ACTAGT 1 cut(s) 133
BfaI CTAG 3 cut(s) 134, 500, 587
BisI GCNGC 3 cut(s) 121, 240, 1069
BlsI GCNGC 3 cut(s) 122, 241, 1070
BmcAI AGTACT 1 cut(s) 900
Bme1390I CCNGG 3 cut(s) 444, 819, 840
Bme18I GGWCC 2 cut(s) 529, 1046
BmgT120I GGNCC 2 cut(s) 529, 1046
BmiI GGNNCC 2 cut(s) 801, 1190
BmrFI CCNGG 3 cut(s) 444, 819, 840
BmrI ACTGGG 1 cut(s) 554
BmsI GCATC 3 cut(s) 86, 232, 488
BmuI ACTGGG 1 cut(s) 554
BplI GAGNNNNNCTC 4 cut(s) 683, 715, 1180, 1212
BpmI CTGGAG 1 cut(s) 108
Bpu14I TTCGAA 1 cut(s) 1239
BpuMI CCSGG 2 cut(s) 444, 819
BsaBI GATNNNNATC 1 cut(s) 638
BsaI GGTCTC 1 cut(s) 373
BsaJI CCNNGG 2 cut(s) 157, 443
BsaXI ACNNNNNCTCC 2 cut(s) 557, 587
Bsc4I CCNNNNNNNGG 4 cut(s) 334, 1055, 1150, 1182
Bse1I ACTGG 2 cut(s) 364, 549
Bse3DI GCAATG 1 cut(s) 396
Bse8I GATNNNNATC 1 cut(s) 638
BseBI CCWGG 1 cut(s) 840
BseDI CCNNGG 2 cut(s) 157, 443
BseGI GGATG 2 cut(s) 101, 165
BseJI GATNNNNATC 1 cut(s) 638
BseLI CCNNNNNNNGG 4 cut(s) 334, 1055, 1150, 1182
BseMI GCAATG 1 cut(s) 396
BseMII CTCAG 1 cut(s) 1083
BseNI ACTGG 2 cut(s) 364, 549
BseXI GCAGC 3 cut(s) 132, 251, 1055
BseYI CCCAGC 2 cut(s) 169, 485
BsgI GTGCAG 1 cut(s) 139
BshFI GGCC 3 cut(s) 213, 351, 1143
BsiHKAI GWGCWC 1 cut(s) 499
BsiSI CCGG 3 cut(s) 443, 818, 1140
BslI CCNNNNNNNGG 4 cut(s) 334, 1055, 1150, 1182
BsmAI GTCTC 2 cut(s) 373, 699
BsnI GGCC 3 cut(s) 213, 351, 1143
Bso31I GGTCTC 1 cut(s) 373
Bsp119I TTCGAA 1 cut(s) 1239
Bsp1286I GDGCHC 1 cut(s) 499
Bsp1407I TGTACA 1 cut(s) 812
Bsp143I GATC 3 cut(s) 14, 190, 747
BspACI CCGC 2 cut(s) 648, 1071
BspANI GGCC 3 cut(s) 213, 351, 1143
BspCNI CTCAG 1 cut(s) 1084
BspLI GGNNCC 2 cut(s) 801, 1190
BspPI GGATC 2 cut(s) 22, 198
BspT104I TTCGAA 1 cut(s) 1239
BspTNI GGTCTC 1 cut(s) 373
BsrDI GCAATG 1 cut(s) 396
BsrGI TGTACA 1 cut(s) 812
BsrI ACTGG 2 cut(s) 364, 549
BssECI CCNNGG 2 cut(s) 157, 443
BssMI GATC 3 cut(s) 14, 190, 747
BssNAI GTATAC 1 cut(s) 1162
Bst1107I GTATAC 1 cut(s) 1162
Bst2UI CCWGG 1 cut(s) 840
BstAUI TGTACA 1 cut(s) 812
BstBI TTCGAA 1 cut(s) 1239
BstC8I GCNNGC 2 cut(s) 793, 1033
BstDEI CTNAG 1 cut(s) 1092
BstF5I GGATG 2 cut(s) 101, 165
BstKTI GATC 3 cut(s) 17, 193, 750
BstMAI GTCTC 2 cut(s) 373, 699
BstMBI GATC 3 cut(s) 14, 190, 747
BstMWI GCNNNNNNNGC 3 cut(s) 210, 407, 577
BstNI CCWGG 1 cut(s) 840
BstNSI RCATGY 3 cut(s) 9, 239, 1035
BstSCI CCNGG 3 cut(s) 442, 817, 838
BstV1I GCAGC 3 cut(s) 132, 251, 1055
BstXI CCANNNNNNTGG 1 cut(s) 359
BstZ17I GTATAC 1 cut(s) 1162
BsuRI GGCC 3 cut(s) 213, 351, 1143
BtsCI GGATG 2 cut(s) 101, 165
Cac8I GCNNGC 2 cut(s) 793, 1033
Cfr13I GGNCC 2 cut(s) 529, 1046
Csp6I GTAC 3 cut(s) 126, 813, 899
CviQI GTAC 3 cut(s) 126, 813, 899
DdeI CTNAG 1 cut(s) 1092
DpnI GATC 3 cut(s) 16, 192, 749
DpnII GATC 3 cut(s) 14, 190, 747
DraI TTTAAA 1 cut(s) 106
EaeI YGGCCR 3 cut(s) 211, 349, 1141
Eco31I GGTCTC 1 cut(s) 373
Eco32I GATATC 1 cut(s) 394
Eco47I GGWCC 2 cut(s) 529, 1046
Eco57I CTGAAG 2 cut(s) 101, 938
EcoRI GAATTC 1 cut(s) 676
EcoRII CCWGG 1 cut(s) 838
EcoRV GATATC 1 cut(s) 394
FauNDI CATATG 1 cut(s) 331
FbaI TGATCA 1 cut(s) 747
FblI GTMKAC 1 cut(s) 1161
Fnu4HI GCNGC 3 cut(s) 121, 240, 1069
FokI GGATG 2 cut(s) 108, 152
Fsp4HI GCNGC 3 cut(s) 121, 240, 1069
FspBI CTAG 3 cut(s) 134, 500, 587
GluI GCNGC 3 cut(s) 121, 240, 1069
GsaI CCCAGC 2 cut(s) 173, 489
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 3 cut(s) 213, 351, 1143
HapII CCGG 3 cut(s) 443, 818, 1140
HinfI GANTC 7 cut(s) 47, 144, 260, 424, 692, 955, 1136
HpaII CCGG 3 cut(s) 443, 818, 1140
HphI GGTGA 3 cut(s) 173, 602, 662
Hpy166II GTNNAC 4 cut(s) 472, 628, 815, 1162
Hpy188I TCNGA 6 cut(s) 81, 158, 228, 373, 619, 644
Hpy188III TCNNGA 2 cut(s) 916, 1199
Hpy8I GTNNAC 4 cut(s) 472, 628, 815, 1162
HpyAV CCTTC 4 cut(s) 76, 181, 352, 1013
HpyCH4IV ACGT 3 cut(s) 509, 608, 1213
HpyCH4V TGCA 8 cut(s) 120, 223, 239, 410, 479, 791, 875, 1148
HpyF10VI GCNNNNNNNGC 3 cut(s) 210, 407, 577
HpyF3I CTNAG 1 cut(s) 1092
HpySE526I ACGT 3 cut(s) 509, 608, 1213
Ksp22I TGATCA 1 cut(s) 747
Kzo9I GATC 3 cut(s) 14, 190, 747
LmnI GCTCC 3 cut(s) 799, 939, 1188
Lsp1109I GCAGC 3 cut(s) 132, 251, 1055
LweI GCATC 3 cut(s) 86, 232, 488
MaeI CTAG 3 cut(s) 134, 500, 587
MaeII ACGT 3 cut(s) 509, 608, 1213
MaeIII GTNAC 7 cut(s) 161, 724, 1087, 1106, 1114, 1204, 1214
MalI GATC 3 cut(s) 16, 192, 749
MboI GATC 3 cut(s) 14, 190, 747
MboII GAAGA 6 cut(s) 244, 316, 337, 719, 786, 875
MhlI GDGCHC 1 cut(s) 499
MlsI TGGCCA 1 cut(s) 213
MluCI AATT 7 cut(s) 319, 676, 779, 876, 961, 1059, 1222
MluNI TGGCCA 1 cut(s) 213
MlyI GAGTC 3 cut(s) 56, 153, 701
MmeI TCCRAC 2 cut(s) 256, 507
MnlI CCTC 8 cut(s) 152, 164, 570, 764, 923, 1049, 1067, 1076
Mox20I TGGCCA 1 cut(s) 213
MroXI GAANNNNTTC 1 cut(s) 510
MscI TGGCCA 1 cut(s) 213
MseI TTAA 3 cut(s) 105, 140, 534
MslI CAYNNNNRTG 1 cut(s) 702
Msp20I TGGCCA 1 cut(s) 213
MspA1I CMGCKG 1 cut(s) 173
MspI CCGG 3 cut(s) 443, 818, 1140
MspR9I CCNGG 3 cut(s) 444, 819, 840
MvaI CCWGG 1 cut(s) 840
MwoI GCNNNNNNNGC 3 cut(s) 210, 407, 577
NciI CCSGG 2 cut(s) 444, 819
NdeI CATATG 1 cut(s) 331
NdeII GATC 3 cut(s) 14, 190, 747
NlaIV GGNNCC 2 cut(s) 801, 1190
NmuCI GTSAC 5 cut(s) 161, 724, 1087, 1106, 1204
NspI RCATGY 3 cut(s) 9, 239, 1035
NspV TTCGAA 1 cut(s) 1239
PaeI GCATGC 1 cut(s) 1035
PciI ACATGT 1 cut(s) 5
PdmI GAANNNNTTC 1 cut(s) 510
PfeI GAWTC 4 cut(s) 260, 424, 955, 1136
PflFI GACNNNGTC 1 cut(s) 1124
PflMI CCANNNNNTGG 1 cut(s) 1182
PkrI GCNGC 3 cut(s) 122, 241, 1070
PleI GAGTC 3 cut(s) 55, 152, 700
PpsI GAGTC 3 cut(s) 55, 152, 700
PscI ACATGT 1 cut(s) 5
Psp1406I AACGTT 1 cut(s) 509
Psp6I CCWGG 1 cut(s) 838
PspFI CCCAGC 2 cut(s) 169, 485
PspGI CCWGG 1 cut(s) 838
PspN4I GGNNCC 2 cut(s) 801, 1190
PspPI GGNCC 2 cut(s) 529, 1046
PsyI GACNNNGTC 1 cut(s) 1124
PvuII CAGCTG 1 cut(s) 173
RsaI GTAC 3 cut(s) 127, 814, 900
RsaNI GTAC 3 cut(s) 126, 813, 899
RseI CAYNNNNRTG 1 cut(s) 702
SaqAI TTAA 3 cut(s) 105, 140, 534
SatI GCNGC 3 cut(s) 121, 240, 1069
Sau3AI GATC 3 cut(s) 14, 190, 747
Sau96I GGNCC 2 cut(s) 529, 1046
ScaI AGTACT 1 cut(s) 900
SchI GAGTC 3 cut(s) 56, 153, 701
ScrFI CCNGG 3 cut(s) 444, 819, 840
SduI GDGCHC 1 cut(s) 499
SfaNI GCATC 3 cut(s) 86, 232, 488
SfuI TTCGAA 1 cut(s) 1239
SinI GGWCC 2 cut(s) 529, 1046
SmiMI CAYNNNNRTG 1 cut(s) 702
SpeI ACTAGT 1 cut(s) 133
SphI GCATGC 1 cut(s) 1035
Sse9I AATT 7 cut(s) 319, 676, 779, 876, 961, 1059, 1222
SsiI CCGC 2 cut(s) 648, 1071
SspMI CTAG 3 cut(s) 134, 500, 587
StyD4I CCNGG 3 cut(s) 442, 817, 838
TaiI ACGT 3 cut(s) 512, 611, 1216
TaqI TCGA 4 cut(s) 450, 690, 953, 1239
TasI AATT 7 cut(s) 319, 676, 779, 876, 961, 1059, 1222
TatI WGTACW 3 cut(s) 125, 812, 898
TfiI GAWTC 4 cut(s) 260, 424, 955, 1136
Tru1I TTAA 3 cut(s) 105, 140, 534
Tru9I TTAA 3 cut(s) 105, 140, 534
TseFI GTSAC 5 cut(s) 161, 724, 1087, 1106, 1204
TseI GCWGC 3 cut(s) 120, 239, 1068
Tsp45I GTSAC 5 cut(s) 161, 724, 1087, 1106, 1204
TspDTI ATGAA 5 cut(s) 238, 658, 720, 934, 980
TspGWI ACGGA 1 cut(s) 1166
Tth111I GACNNNGTC 1 cut(s) 1124
Van91I CCANNNNNTGG 1 cut(s) 1182
VpaK11BI GGWCC 2 cut(s) 529, 1046
XapI RAATTY 4 cut(s) 319, 676, 779, 961
XceI RCATGY 3 cut(s) 9, 239, 1035
XmiI GTMKAC 1 cut(s) 1161
XmnI GAANNNNTTC 1 cut(s) 510
XspI CTAG 3 cut(s) 134, 500, 587
ZrmI AGTACT 1 cut(s) 900
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.