Rmu_sc0021146.1_g000001

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021146.1
Physical Location & Seq
Reverse (-)
399 .. 2081
1683 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021146.1_g000001.1.cds

Sequence Viewer

Length: 1113 bp
atggcaacttcttcaagatttcaagtatatgtcctggctttttgtgcaacccttcttattcaaggtggctgttatggccattctgtgcatcagagaaaacatgcagccttgttcatcttcggggattcactatttgatgttggaaataataactacataaacacttccactaactttcaagcaaatttcttcccatatggggaaaccttcttcggccacccgactggtagggtctccgatggtcgtctaatgacagatatcattgctgaatatgcaaacttgccaatgattccaccatacttacaaccggggttcgacaactatactaatggtgtgaactttgcatctgctggggctggtgctctagctgaaacgtttcaaggatttgtgttggaccttaaaactcaactgggttatttcaagaatgtggagaagcagttgaggcacagactaggtgaagcagaagctcacagatttttgtccgaagctgtttacttgattagcattggaagcaatgattacattgccccattcataacgaattcaagtttgttcgagtctcactcacatgaagaatatgttggcatggtcacaggaaacctgacaaatgtgatcaaagaaatatacaagaaaggaggaagaaaatttgggattgcaggcatggagcctttgggttgtacaccgggcatgagaacagataaaccaggaaacacaagcacctgtaaagaagaagtaaatgcaatttcaaaactccacaatagagtacttgctaaagtcctcctgaagctgaaaggacagctccaagatttcatatactcgaatccaaatttctactattacctaaatgacatagttcataatccatcaaaacatggtttcaaggaaggaaagatggcatgctgtggctctggtccatacagaggaattatgagctgcggagggaagcgaggtgtgactgagtatcagttatgtgacaatgttactgactatgtcttttttgattccggccatgcaacggaaagggtataccagaaagtttccaagttatggtggagccatactcctgatgtcacagcacgttacatcaatttgaaagagctattcgaagtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

370

Amino Acids

41.36

Weight (kDa)

8.03

Isoelectric Point (pI)

21.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000193)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53940 AT1G53940 AT1G53970 AT1G53970 AT1G53990 AT3G14225 AT3G14225 AT5G40990
fragaria_vesca FvH4_6g34510 FvH4_6g35571 FvH4_6g35571 FvH4_6g35572 FvH4_6g35580 FvH4_6g35580 FvH4_6g35584 FvH4_6g35600 FvH4_6g35610 FvH4_6g35630 FvH4_6g35631
malus_domestica MD00G1137100.v1.1 MD01G1122400.v1.1 MD07G1191900.v1.1 MD09G1174600.v1.1 MD09G1174700.v1.1 MD09G1175100.v1.1 MD17G1151700.v1.1 MD17G1151800.v1.1
prunus_persica Prupe.3G032700_v2.0.a1 Prupe.3G032900_v2.0.a1 Prupe.3G033100_v2.0.a1 Prupe.3G033200_v2.0.a1 Prupe.3G033300_v2.0.a1 Prupe.3G033400_v2.0.a1 Prupe.3G033500_v2.0.a1 Prupe.3G033600_v2.0.a1
pyrus_communis pycom01g14930 pycom09g09170 pycom09g09180 pycom09g09190 pycom09g09220 pycom17g14510
rosa_chinensis RchiOBHm_Chr2g0147161 RchiOBHm_Chr2g0147301 RchiOBHm_Chr2g0147311 RchiOBHm_Chr2g0147391 RchiOBHm_Chr2g0147431 RchiOBHm_Chr2g0147441 RchiOBHm_Chr2g0147471 RchiOBHm_Chr2g0147491 RchiOBHm_Chr2g0147591 RchiOBHm_Chr2g0147911 RchiOBHm_Chr2g0148061 RchiOBHm_Chr4g0407441 RchiOBHm_Chr4g0407471 RchiOBHm_Chr6g0252881 RchiOBHm_Chr7g0228391 RchiOBHm_Chr7g0228411
rosa_laevigata RLG00000001566 RLG00000020247 RLG00000020250 RLG00000020251 RLG00000020252 RLG00000020255 RLG00000020258 RLG00000020261 RLG00000020262 RLG00000020264 RLG00000020293 RLG00000020307 RLG00000030814
rosa_multiflora Rmu_co8112460.1_g000001 Rmu_co8353483.1_g000001 Rmu_co8492209.1_g000001 Rmu_sc0000308.1_g000061 Rmu_sc0000538.1_g000003 Rmu_sc0001159.1_g000017 Rmu_sc0001159.1_g000023 Rmu_sc0001159.1_g000050 Rmu_sc0001880.1_g000011 Rmu_sc0006302.1_g000003 Rmu_sc0008083.1_g000003 Rmu_sc0010661.1_g000002 Rmu_sc0017091.1_g000001 Rmu_sc0021146.1_g000001
rosa_roxburghii Rroxscaffold_2G00099470 Rroxscaffold_2G00099500 Rroxscaffold_2G00099530 Rroxscaffold_2G00099590 Rroxscaffold_2G00113160 Rroxscaffold_2G00113180 Rroxscaffold_3G00231150 Rroxscaffold_4G00332370 Rroxscaffold_5G00352070
rosa_rugosa Rorug02G0398800 Rorug02G0399100 Rorug02G0399200 Rorug02G0399300 Rorug02G0400100 Rorug02G0400200 Rorug02G0400300.1 Rorug02G0403000 Rorug05G0546600 Rorug05G0547200 Rorug07G0249100 Rorug07G0249200.1 RorugPtG0001700.1
rosa_samantha Rh1CG003800 Rh2AG456000 Rh2AG456200 Rh2AG456400 Rh2AG456500 Rh2AG456900 Rh2AG457200 Rh2AG457500 Rh2AG457600 Rh2AG457700 Rh2AG460000 Rh2AG460400 Rh2BG468900 Rh2BG469000 Rh2BG469800 Rh2BG469900 Rh2BG470000 Rh2BG473300 Rh2BG473800 Rh2CG443400 Rh2CG443800 Rh2CG443900 Rh2CG444400 Rh2CG444600 Rh2CG445000 Rh2CG445100 Rh2CG447300 Rh2CG447600 Rh2DG478200 Rh2DG478300 Rh2DG479300 Rh2DG479500 Rh2DG482200 Rh4AG048300 Rh4CG051600 Rh4CG051700 Rh4CG151200 Rh7AG401800 Rh7CG420700 Rh7DG397900
rosa_wichuraiana Rw2G037300 Rw2G037330 Rw2G037350 Rw2G037360 Rw2G037390 Rw2G037410 Rw2G037620 Rw4G003830 Rw6G005020 Rw6G005580 Rw7G033400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 1047
AccI GTMKAC 1 cut(s) 1026
AciI CCGC 1 cut(s) 936
AclI AACGTT 1 cut(s) 374
AcoI YGGCCR 3 cut(s) 76, 214, 1006
AcsI RAATTY 4 cut(s) 184, 541, 644, 826
AcuI CTGAAG 1 cut(s) 803
AfaI GTAC 2 cut(s) 679, 765
AfiI CCNNNNNNNGG 4 cut(s) 199, 920, 1015, 1047
AjnI CCWGG 2 cut(s) 33, 703
AjuI GAANNNNNNNTTGG 2 cut(s) 564, 596
AluBI AGCT 7 cut(s) 368, 467, 488, 787, 799, 933, 1099
AluI AGCT 7 cut(s) 368, 467, 488, 787, 799, 933, 1099
Alw21I GWGCWC 1 cut(s) 364
Alw26I GTCTC 2 cut(s) 238, 564
AoxI GGCC 3 cut(s) 76, 214, 1006
ApeKI GCWGC 2 cut(s) 104, 933
ApoI RAATTY 4 cut(s) 184, 541, 644, 826
Asp700I GAANNNNTTC 1 cut(s) 375
AspS9I GGNCC 2 cut(s) 394, 911
AsuC2I CCSGG 2 cut(s) 309, 684
AsuHPI GGTGA 1 cut(s) 467
AsuII TTCGAA 1 cut(s) 1104
AvaII GGWCC 2 cut(s) 394, 911
BalI TGGCCA 1 cut(s) 78
Bbv12I GWGCWC 1 cut(s) 364
BbvI GCAGC 2 cut(s) 116, 920
BccI CCATC 3 cut(s) 233, 871, 886
BciT130I CCWGG 2 cut(s) 35, 705
BclI TGATCA 1 cut(s) 612
BcnI CCSGG 2 cut(s) 309, 684
BcoDI GTCTC 2 cut(s) 238, 564
BfaI CTAG 2 cut(s) 365, 452
BisI GCNGC 2 cut(s) 105, 934
BlsI GCNGC 2 cut(s) 106, 935
BmcAI AGTACT 1 cut(s) 765
Bme1390I CCNGG 4 cut(s) 35, 309, 684, 705
Bme18I GGWCC 2 cut(s) 394, 911
BmgT120I GGNCC 2 cut(s) 394, 911
BmiI GGNNCC 2 cut(s) 666, 1055
BmrFI CCNGG 4 cut(s) 35, 309, 684, 705
BmrI ACTGGG 1 cut(s) 419
BmsI GCATC 2 cut(s) 97, 353
BmuI ACTGGG 1 cut(s) 419
BplI GAGNNNNNCTC 4 cut(s) 548, 580, 1045, 1077
Bpu14I TTCGAA 1 cut(s) 1104
BpuMI CCSGG 2 cut(s) 309, 684
BsaI GGTCTC 1 cut(s) 238
BsaJI CCNNGG 1 cut(s) 308
BsaXI ACNNNNNCTCC 2 cut(s) 422, 452
Bsc4I CCNNNNNNNGG 4 cut(s) 199, 920, 1015, 1047
Bse1I ACTGG 2 cut(s) 229, 414
Bse3DI GCAATG 3 cut(s) 261, 520, 522
BseBI CCWGG 2 cut(s) 35, 705
BseDI CCNNGG 1 cut(s) 308
BseLI CCNNNNNNNGG 4 cut(s) 199, 920, 1015, 1047
BseMI GCAATG 3 cut(s) 261, 520, 522
BseMII CTCAG 1 cut(s) 948
BseNI ACTGG 2 cut(s) 229, 414
BseXI GCAGC 2 cut(s) 116, 920
BseYI CCCAGC 1 cut(s) 350
BshFI GGCC 3 cut(s) 78, 216, 1008
BsiHKAI GWGCWC 1 cut(s) 364
BsiSI CCGG 3 cut(s) 308, 683, 1005
BslI CCNNNNNNNGG 4 cut(s) 199, 920, 1015, 1047
BsmAI GTCTC 2 cut(s) 238, 564
BsnI GGCC 3 cut(s) 78, 216, 1008
Bso31I GGTCTC 1 cut(s) 238
Bsp119I TTCGAA 1 cut(s) 1104
Bsp1286I GDGCHC 1 cut(s) 364
Bsp1407I TGTACA 1 cut(s) 677
Bsp143I GATC 1 cut(s) 612
BspACI CCGC 1 cut(s) 936
BspANI GGCC 3 cut(s) 78, 216, 1008
BspCNI CTCAG 1 cut(s) 949
BspLI GGNNCC 2 cut(s) 666, 1055
BspT104I TTCGAA 1 cut(s) 1104
BspTNI GGTCTC 1 cut(s) 238
BsrDI GCAATG 3 cut(s) 261, 520, 522
BsrGI TGTACA 1 cut(s) 677
BsrI ACTGG 2 cut(s) 229, 414
BssECI CCNNGG 1 cut(s) 308
BssMI GATC 1 cut(s) 612
BssNAI GTATAC 1 cut(s) 1027
Bst1107I GTATAC 1 cut(s) 1027
Bst2UI CCWGG 2 cut(s) 35, 705
BstAUI TGTACA 1 cut(s) 677
BstBI TTCGAA 1 cut(s) 1104
BstC8I GCNNGC 2 cut(s) 658, 898
BstDEI CTNAG 1 cut(s) 957
BstKTI GATC 1 cut(s) 615
BstMAI GTCTC 2 cut(s) 238, 564
BstMBI GATC 1 cut(s) 612
BstMWI GCNNNNNNNGC 5 cut(s) 44, 75, 272, 442, 510
BstNI CCWGG 2 cut(s) 35, 705
BstNSI RCATGY 2 cut(s) 104, 900
BstSCI CCNGG 4 cut(s) 33, 307, 682, 703
BstV1I GCAGC 2 cut(s) 116, 920
BstXI CCANNNNNNTGG 1 cut(s) 224
BstZ17I GTATAC 1 cut(s) 1027
BsuRI GGCC 3 cut(s) 78, 216, 1008
Cac8I GCNNGC 2 cut(s) 658, 898
Cfr13I GGNCC 2 cut(s) 394, 911
Csp6I GTAC 2 cut(s) 678, 764
CviAII CATG 8 cut(s) 101, 569, 586, 661, 688, 872, 897, 1010
CviQI GTAC 2 cut(s) 678, 764
DdeI CTNAG 1 cut(s) 957
DpnI GATC 1 cut(s) 614
DpnII GATC 1 cut(s) 612
EaeI YGGCCR 3 cut(s) 76, 214, 1006
Eco31I GGTCTC 1 cut(s) 238
Eco32I GATATC 1 cut(s) 259
Eco47I GGWCC 2 cut(s) 394, 911
Eco57I CTGAAG 1 cut(s) 803
EcoRI GAATTC 1 cut(s) 541
EcoRII CCWGG 2 cut(s) 33, 703
EcoRV GATATC 1 cut(s) 259
FaeI CATG 8 cut(s) 104, 572, 589, 664, 691, 875, 900, 1013
FatI CATG 8 cut(s) 100, 568, 585, 660, 687, 871, 896, 1009
FauNDI CATATG 1 cut(s) 196
FbaI TGATCA 1 cut(s) 612
FblI GTMKAC 1 cut(s) 1026
Fnu4HI GCNGC 2 cut(s) 105, 934
Fsp4HI GCNGC 2 cut(s) 105, 934
FspBI CTAG 2 cut(s) 365, 452
GluI GCNGC 2 cut(s) 105, 934
GsaI CCCAGC 1 cut(s) 354
HaeIII GGCC 3 cut(s) 78, 216, 1008
HapII CCGG 3 cut(s) 308, 683, 1005
Hin1II CATG 8 cut(s) 104, 572, 589, 664, 691, 875, 900, 1013
HinfI GANTC 5 cut(s) 125, 289, 557, 820, 1001
HpaII CCGG 3 cut(s) 308, 683, 1005
HphI GGTGA 1 cut(s) 467
Hpy166II GTNNAC 4 cut(s) 337, 493, 680, 1027
Hpy188I TCNGA 3 cut(s) 93, 238, 484
Hpy188III TCNNGA 4 cut(s) 15, 421, 781, 1064
Hpy8I GTNNAC 4 cut(s) 337, 493, 680, 1027
HpyAV CCTTC 3 cut(s) 62, 217, 878
HpyCH4IV ACGT 2 cut(s) 374, 1078
HpyCH4V TGCA 8 cut(s) 47, 88, 104, 275, 344, 656, 740, 1013
HpyF10VI GCNNNNNNNGC 5 cut(s) 44, 75, 272, 442, 510
HpyF3I CTNAG 1 cut(s) 957
HpySE526I ACGT 2 cut(s) 374, 1078
Hsp92II CATG 8 cut(s) 104, 572, 589, 664, 691, 875, 900, 1013
Ksp22I TGATCA 1 cut(s) 612
Kzo9I GATC 1 cut(s) 612
LmnI GCTCC 3 cut(s) 664, 804, 1053
Lsp1109I GCAGC 2 cut(s) 116, 920
LweI GCATC 2 cut(s) 97, 353
MaeI CTAG 2 cut(s) 365, 452
MaeII ACGT 2 cut(s) 374, 1078
MaeIII GTNAC 6 cut(s) 589, 952, 971, 979, 1069, 1079
MalI GATC 1 cut(s) 614
MboI GATC 1 cut(s) 612
MboII GAAGA 7 cut(s) 3, 109, 181, 202, 584, 651, 740
MhlI GDGCHC 1 cut(s) 364
MlsI TGGCCA 1 cut(s) 78
MluCI AATT 7 cut(s) 184, 541, 644, 741, 826, 924, 1087
MluNI TGGCCA 1 cut(s) 78
MlyI GAGTC 1 cut(s) 566
MmeI TCCRAC 2 cut(s) 121, 372
MnlI CCTC 6 cut(s) 435, 629, 788, 914, 932, 941
Mox20I TGGCCA 1 cut(s) 78
MroXI GAANNNNTTC 1 cut(s) 375
MscI TGGCCA 1 cut(s) 78
MseI TTAA 1 cut(s) 399
MslI CAYNNNNRTG 1 cut(s) 567
Msp20I TGGCCA 1 cut(s) 78
MspI CCGG 3 cut(s) 308, 683, 1005
MspR9I CCNGG 4 cut(s) 35, 309, 684, 705
MvaI CCWGG 2 cut(s) 35, 705
MwoI GCNNNNNNNGC 5 cut(s) 44, 75, 272, 442, 510
NciI CCSGG 2 cut(s) 309, 684
NdeI CATATG 1 cut(s) 196
NdeII GATC 1 cut(s) 612
NlaIII CATG 8 cut(s) 104, 572, 589, 664, 691, 875, 900, 1013
NlaIV GGNNCC 2 cut(s) 666, 1055
NmuCI GTSAC 4 cut(s) 589, 952, 971, 1069
NspI RCATGY 2 cut(s) 104, 900
NspV TTCGAA 1 cut(s) 1104
PaeI GCATGC 1 cut(s) 900
PdmI GAANNNNTTC 1 cut(s) 375
PfeI GAWTC 4 cut(s) 125, 289, 820, 1001
PflFI GACNNNGTC 1 cut(s) 989
PflMI CCANNNNNTGG 1 cut(s) 1047
PkrI GCNGC 2 cut(s) 106, 935
PleI GAGTC 1 cut(s) 565
PpsI GAGTC 1 cut(s) 565
Psp1406I AACGTT 1 cut(s) 374
Psp6I CCWGG 2 cut(s) 33, 703
PspFI CCCAGC 1 cut(s) 350
PspGI CCWGG 2 cut(s) 33, 703
PspN4I GGNNCC 2 cut(s) 666, 1055
PspPI GGNCC 2 cut(s) 394, 911
PsyI GACNNNGTC 1 cut(s) 989
RsaI GTAC 2 cut(s) 679, 765
RsaNI GTAC 2 cut(s) 678, 764
RseI CAYNNNNRTG 1 cut(s) 567
SaqAI TTAA 1 cut(s) 399
SatI GCNGC 2 cut(s) 105, 934
Sau3AI GATC 1 cut(s) 612
Sau96I GGNCC 2 cut(s) 394, 911
ScaI AGTACT 1 cut(s) 765
SchI GAGTC 1 cut(s) 566
ScrFI CCNGG 4 cut(s) 35, 309, 684, 705
SduI GDGCHC 1 cut(s) 364
SfaNI GCATC 2 cut(s) 97, 353
SfuI TTCGAA 1 cut(s) 1104
SinI GGWCC 2 cut(s) 394, 911
SmiMI CAYNNNNRTG 1 cut(s) 567
SphI GCATGC 1 cut(s) 900
Sse9I AATT 7 cut(s) 184, 541, 644, 741, 826, 924, 1087
SsiI CCGC 1 cut(s) 936
SspMI CTAG 2 cut(s) 365, 452
StyD4I CCNGG 4 cut(s) 33, 307, 682, 703
TaiI ACGT 2 cut(s) 377, 1081
TaqI TCGA 4 cut(s) 315, 555, 818, 1104
TasI AATT 7 cut(s) 184, 541, 644, 741, 826, 924, 1087
TatI WGTACW 2 cut(s) 677, 763
TfiI GAWTC 4 cut(s) 125, 289, 820, 1001
Tru1I TTAA 1 cut(s) 399
Tru9I TTAA 1 cut(s) 399
TseFI GTSAC 4 cut(s) 589, 952, 971, 1069
TseI GCWGC 2 cut(s) 104, 933
Tsp45I GTSAC 4 cut(s) 589, 952, 971, 1069
TspDTI ATGAA 5 cut(s) 103, 523, 585, 799, 845
TspGWI ACGGA 1 cut(s) 1031
Tth111I GACNNNGTC 1 cut(s) 989
Van91I CCANNNNNTGG 1 cut(s) 1047
VpaK11BI GGWCC 2 cut(s) 394, 911
XapI RAATTY 4 cut(s) 184, 541, 644, 826
XceI RCATGY 2 cut(s) 104, 900
XmiI GTMKAC 1 cut(s) 1026
XmnI GAANNNNTTC 1 cut(s) 375
XspI CTAG 2 cut(s) 365, 452
ZrmI AGTACT 1 cut(s) 765
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.