Rh2AG457500

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000193
Physical Location & Seq
Reverse (-)
67281412 .. 67289160
7749 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG457500.1

Sequence Viewer

Length: 195 bp
ATGAAAGAAAAGAAAGAGGAGAAGAAGAAACAAGATAGATGTGTGAAATGGAATGAAGTGATGAGTGAAAAGTTGAAGAAAGGGAGATTTGCCGATTTGAGGAAAGGAAAGCTCCAAGGATTCAAATATTCAAATCCAGATTTCTACAGTTACTTAAATGGAATATTTAACAATCCTGCAAATTCTGGTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

64

Amino Acids

7.6

Weight (kDa)

9.79

Isoelectric Point (pI)

28.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000193)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53940 AT1G53940 AT1G53970 AT1G53970 AT1G53990 AT3G14225 AT3G14225 AT5G40990
fragaria_vesca FvH4_6g34510 FvH4_6g35571 FvH4_6g35571 FvH4_6g35572 FvH4_6g35580 FvH4_6g35580 FvH4_6g35584 FvH4_6g35600 FvH4_6g35610 FvH4_6g35630 FvH4_6g35631
malus_domestica MD00G1137100.v1.1 MD01G1122400.v1.1 MD07G1191900.v1.1 MD09G1174600.v1.1 MD09G1174700.v1.1 MD09G1175100.v1.1 MD17G1151700.v1.1 MD17G1151800.v1.1
prunus_persica Prupe.3G032700_v2.0.a1 Prupe.3G032900_v2.0.a1 Prupe.3G033100_v2.0.a1 Prupe.3G033200_v2.0.a1 Prupe.3G033300_v2.0.a1 Prupe.3G033400_v2.0.a1 Prupe.3G033500_v2.0.a1 Prupe.3G033600_v2.0.a1
pyrus_communis pycom01g14930 pycom09g09170 pycom09g09180 pycom09g09190 pycom09g09220 pycom17g14510
rosa_chinensis RchiOBHm_Chr2g0147161 RchiOBHm_Chr2g0147301 RchiOBHm_Chr2g0147311 RchiOBHm_Chr2g0147391 RchiOBHm_Chr2g0147431 RchiOBHm_Chr2g0147441 RchiOBHm_Chr2g0147471 RchiOBHm_Chr2g0147491 RchiOBHm_Chr2g0147591 RchiOBHm_Chr2g0147911 RchiOBHm_Chr2g0148061 RchiOBHm_Chr4g0407441 RchiOBHm_Chr4g0407471 RchiOBHm_Chr6g0252881 RchiOBHm_Chr7g0228391 RchiOBHm_Chr7g0228411
rosa_laevigata RLG00000001566 RLG00000020247 RLG00000020250 RLG00000020251 RLG00000020252 RLG00000020255 RLG00000020258 RLG00000020261 RLG00000020262 RLG00000020264 RLG00000020293 RLG00000020307 RLG00000030814
rosa_multiflora Rmu_co8112460.1_g000001 Rmu_co8353483.1_g000001 Rmu_co8492209.1_g000001 Rmu_sc0000308.1_g000061 Rmu_sc0000538.1_g000003 Rmu_sc0001159.1_g000017 Rmu_sc0001159.1_g000023 Rmu_sc0001159.1_g000050 Rmu_sc0001880.1_g000011 Rmu_sc0006302.1_g000003 Rmu_sc0008083.1_g000003 Rmu_sc0010661.1_g000002 Rmu_sc0017091.1_g000001 Rmu_sc0021146.1_g000001
rosa_roxburghii Rroxscaffold_2G00099470 Rroxscaffold_2G00099500 Rroxscaffold_2G00099530 Rroxscaffold_2G00099590 Rroxscaffold_2G00113160 Rroxscaffold_2G00113180 Rroxscaffold_3G00231150 Rroxscaffold_4G00332370 Rroxscaffold_5G00352070
rosa_rugosa Rorug02G0398800 Rorug02G0399100 Rorug02G0399200 Rorug02G0399300 Rorug02G0400100 Rorug02G0400200 Rorug02G0400300.1 Rorug02G0403000 Rorug05G0546600 Rorug05G0547200 Rorug07G0249100 Rorug07G0249200.1 RorugPtG0001700.1
rosa_samantha Rh1CG003800 Rh2AG456000 Rh2AG456200 Rh2AG456400 Rh2AG456500 Rh2AG456900 Rh2AG457200 Rh2AG457500 Rh2AG457600 Rh2AG457700 Rh2AG460000 Rh2AG460400 Rh2BG468900 Rh2BG469000 Rh2BG469800 Rh2BG469900 Rh2BG470000 Rh2BG473300 Rh2BG473800 Rh2CG443400 Rh2CG443800 Rh2CG443900 Rh2CG444400 Rh2CG444600 Rh2CG445000 Rh2CG445100 Rh2CG447300 Rh2CG447600 Rh2DG478200 Rh2DG478300 Rh2DG479300 Rh2DG479500 Rh2DG482200 Rh4AG048300 Rh4CG051600 Rh4CG051700 Rh4CG151200 Rh7AG401800 Rh7CG420700 Rh7DG397900
rosa_wichuraiana Rw2G037300 Rw2G037330 Rw2G037350 Rw2G037360 Rw2G037390 Rw2G037410 Rw2G037620 Rw4G003830 Rw6G005020 Rw6G005580 Rw7G033400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 181
AfiI CCNNNNNNNGG 1 cut(s) 99
AgsI TTSAA 3 cut(s) 76, 124, 132
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
ApoI RAATTY 1 cut(s) 181
BfaI CTAG 1 cut(s) 193
BfmI CTRYAG 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 115
Bsc4I CCNNNNNNNGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 99
BseRI GAGGAG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 115
BssT1I CCWWGG 1 cut(s) 115
Bst4CI ACNGT 1 cut(s) 149
BstSFI CTRYAG 1 cut(s) 145
CviJI RGCY 1 cut(s) 112
CviKI_1 RGCY 1 cut(s) 112
Eco130I CCWWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 115
FspBI CTAG 1 cut(s) 193
HinfI GANTC 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 179
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 3 cut(s) 150, 171, 189
MaeI CTAG 1 cut(s) 193
MaeIII GTNAC 1 cut(s) 149
MboII GAAGA 3 cut(s) 34, 37, 88
MluCI AATT 1 cut(s) 181
MnlI CCTC 2 cut(s) 10, 93
MseI TTAA 2 cut(s) 155, 168
PfeI GAWTC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 155, 168
SetI ASST 1 cut(s) 114
SfcI CTRYAG 1 cut(s) 145
SgeI CNNG 4 cut(s) 44, 128, 149, 188
Sse9I AATT 1 cut(s) 181
SspI AATATT 2 cut(s) 128, 165
SspMI CTAG 1 cut(s) 193
StyI CCWWGG 1 cut(s) 115
TaaI ACNGT 1 cut(s) 149
TasI AATT 1 cut(s) 181
TfiI GAWTC 1 cut(s) 120
Tru1I TTAA 2 cut(s) 155, 168
Tru9I TTAA 2 cut(s) 155, 168
TspDTI ATGAA 2 cut(s) 17, 69
XapI RAATTY 1 cut(s) 181
XspI CTAG 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.