Rmu_co8112460.1_g000001

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8112460.1
OG0000193
Physical Location & Seq
Reverse (-)
1 .. 553
553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8112460.1_g000001.1.cds

Sequence Viewer

Length: 387 bp
atgacaacttcttcaagatttcaagtatatgtcctggctttttgtgcaacccttcttattcaaagtggctgttatggccattctgtgcatcagagaaaacatacagccttgttcatcttcggggattcaacatttgatgttggaaataataactacataaacacttccactttctttcaagcaaatttcttcccatatggggaaaccttcttcagccacccgactggtaggttctccgatggtcgtctaatcccagatatcattgctgaatatgcaaacttgccaatgattccaccatacttacagccgggtttcgacaactatactaatggggtgaactttgcatcttctggggctggtgttctagctgaaactcatcaaggattt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

129

Amino Acids

14.31

Weight (kDa)

5.85

Isoelectric Point (pI)

20.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000193)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53940 AT1G53940 AT1G53970 AT1G53970 AT1G53990 AT3G14225 AT3G14225 AT5G40990
fragaria_vesca FvH4_6g34510 FvH4_6g35571 FvH4_6g35571 FvH4_6g35572 FvH4_6g35580 FvH4_6g35580 FvH4_6g35584 FvH4_6g35600 FvH4_6g35610 FvH4_6g35630 FvH4_6g35631
malus_domestica MD00G1137100.v1.1 MD01G1122400.v1.1 MD07G1191900.v1.1 MD09G1174600.v1.1 MD09G1174700.v1.1 MD09G1175100.v1.1 MD17G1151700.v1.1 MD17G1151800.v1.1
prunus_persica Prupe.3G032700_v2.0.a1 Prupe.3G032900_v2.0.a1 Prupe.3G033100_v2.0.a1 Prupe.3G033200_v2.0.a1 Prupe.3G033300_v2.0.a1 Prupe.3G033400_v2.0.a1 Prupe.3G033500_v2.0.a1 Prupe.3G033600_v2.0.a1
pyrus_communis pycom01g14930 pycom09g09170 pycom09g09180 pycom09g09190 pycom09g09220 pycom17g14510
rosa_chinensis RchiOBHm_Chr2g0147161 RchiOBHm_Chr2g0147301 RchiOBHm_Chr2g0147311 RchiOBHm_Chr2g0147391 RchiOBHm_Chr2g0147431 RchiOBHm_Chr2g0147441 RchiOBHm_Chr2g0147471 RchiOBHm_Chr2g0147491 RchiOBHm_Chr2g0147591 RchiOBHm_Chr2g0147911 RchiOBHm_Chr2g0148061 RchiOBHm_Chr4g0407441 RchiOBHm_Chr4g0407471 RchiOBHm_Chr6g0252881 RchiOBHm_Chr7g0228391 RchiOBHm_Chr7g0228411
rosa_laevigata RLG00000001566 RLG00000020247 RLG00000020250 RLG00000020251 RLG00000020252 RLG00000020255 RLG00000020258 RLG00000020261 RLG00000020262 RLG00000020264 RLG00000020293 RLG00000020307 RLG00000030814
rosa_multiflora Rmu_co8112460.1_g000001 Rmu_co8353483.1_g000001 Rmu_co8492209.1_g000001 Rmu_sc0000308.1_g000061 Rmu_sc0000538.1_g000003 Rmu_sc0001159.1_g000017 Rmu_sc0001159.1_g000023 Rmu_sc0001159.1_g000050 Rmu_sc0001880.1_g000011 Rmu_sc0006302.1_g000003 Rmu_sc0008083.1_g000003 Rmu_sc0010661.1_g000002 Rmu_sc0017091.1_g000001 Rmu_sc0021146.1_g000001
rosa_roxburghii Rroxscaffold_2G00099470 Rroxscaffold_2G00099500 Rroxscaffold_2G00099530 Rroxscaffold_2G00099590 Rroxscaffold_2G00113160 Rroxscaffold_2G00113180 Rroxscaffold_3G00231150 Rroxscaffold_4G00332370 Rroxscaffold_5G00352070
rosa_rugosa Rorug02G0398800 Rorug02G0399100 Rorug02G0399200 Rorug02G0399300 Rorug02G0400100 Rorug02G0400200 Rorug02G0400300.1 Rorug02G0403000 Rorug05G0546600 Rorug05G0547200 Rorug07G0249100 Rorug07G0249200.1 RorugPtG0001700.1
rosa_samantha Rh1CG003800 Rh2AG456000 Rh2AG456200 Rh2AG456400 Rh2AG456500 Rh2AG456900 Rh2AG457200 Rh2AG457500 Rh2AG457600 Rh2AG457700 Rh2AG460000 Rh2AG460400 Rh2BG468900 Rh2BG469000 Rh2BG469800 Rh2BG469900 Rh2BG470000 Rh2BG473300 Rh2BG473800 Rh2CG443400 Rh2CG443800 Rh2CG443900 Rh2CG444400 Rh2CG444600 Rh2CG445000 Rh2CG445100 Rh2CG447300 Rh2CG447600 Rh2DG478200 Rh2DG478300 Rh2DG479300 Rh2DG479500 Rh2DG482200 Rh4AG048300 Rh4CG051600 Rh4CG051700 Rh4CG151200 Rh7AG401800 Rh7CG420700 Rh7DG397900
rosa_wichuraiana Rw2G037300 Rw2G037330 Rw2G037350 Rw2G037360 Rw2G037390 Rw2G037410 Rw2G037620 Rw4G003830 Rw6G005020 Rw6G005580 Rw7G033400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 76
AcsI RAATTY 1 cut(s) 184
AcuI CTGAAG 1 cut(s) 196
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 5 cut(s) 15, 23, 62, 129, 179
AjnI CCWGG 1 cut(s) 33
AluBI AGCT 1 cut(s) 368
AluI AGCT 1 cut(s) 368
AoxI GGCC 1 cut(s) 76
ApoI RAATTY 1 cut(s) 184
AsuC2I CCSGG 1 cut(s) 309
AsuHPI GGTGA 1 cut(s) 346
BalI TGGCCA 1 cut(s) 78
BccI CCATC 1 cut(s) 233
BciT130I CCWGG 1 cut(s) 35
BcnI CCSGG 1 cut(s) 309
BfaI CTAG 1 cut(s) 365
Bme1390I CCNGG 2 cut(s) 35, 309
BmrFI CCNGG 2 cut(s) 35, 309
BmsI GCATC 2 cut(s) 97, 353
BpuMI CCSGG 1 cut(s) 309
Bsc4I CCNNNNNNNGG 1 cut(s) 199
Bse1I ACTGG 1 cut(s) 229
Bse3DI GCAATG 1 cut(s) 261
BseBI CCWGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 199
BseMI GCAATG 1 cut(s) 261
BseNI ACTGG 1 cut(s) 229
BshFI GGCC 1 cut(s) 78
BsiSI CCGG 1 cut(s) 308
BslI CCNNNNNNNGG 1 cut(s) 199
BsnI GGCC 1 cut(s) 78
BspANI GGCC 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 261
BsrI ACTGG 1 cut(s) 229
Bst2UI CCWGG 1 cut(s) 35
BstMWI GCNNNNNNNGC 3 cut(s) 44, 75, 272
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 2 cut(s) 33, 307
BstXI CCANNNNNNTGG 1 cut(s) 224
BsuRI GGCC 1 cut(s) 78
CviJI RGCY 8 cut(s) 38, 69, 78, 107, 216, 307, 356, 368
CviKI_1 RGCY 8 cut(s) 38, 69, 78, 107, 216, 307, 356, 368
EaeI YGGCCR 1 cut(s) 76
Eco32I GATATC 1 cut(s) 259
Eco57I CTGAAG 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 33
EcoRV GATATC 1 cut(s) 259
FauNDI CATATG 1 cut(s) 196
FspBI CTAG 1 cut(s) 365
HaeIII GGCC 1 cut(s) 78
HapII CCGG 1 cut(s) 308
HinfI GANTC 2 cut(s) 125, 289
HpaII CCGG 1 cut(s) 308
HphI GGTGA 1 cut(s) 346
Hpy166II GTNNAC 1 cut(s) 337
Hpy188I TCNGA 2 cut(s) 93, 238
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 337
HpyAV CCTTC 2 cut(s) 62, 217
HpyCH4V TGCA 4 cut(s) 47, 88, 275, 344
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 75, 272
LpnPI CCDG 7 cut(s) 20, 47, 210, 267, 321, 336, 342
LweI GCATC 2 cut(s) 97, 353
MaeI CTAG 1 cut(s) 365
MboII GAAGA 5 cut(s) 3, 109, 181, 202, 339
MlsI TGGCCA 1 cut(s) 78
MluCI AATT 1 cut(s) 184
MluNI TGGCCA 1 cut(s) 78
MmeI TCCRAC 1 cut(s) 121
Mox20I TGGCCA 1 cut(s) 78
MscI TGGCCA 1 cut(s) 78
Msp20I TGGCCA 1 cut(s) 78
MspI CCGG 1 cut(s) 308
MspR9I CCNGG 2 cut(s) 35, 309
MvaI CCWGG 1 cut(s) 35
MwoI GCNNNNNNNGC 3 cut(s) 44, 75, 272
NciI CCSGG 1 cut(s) 309
NdeI CATATG 1 cut(s) 196
PfeI GAWTC 2 cut(s) 125, 289
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
ScrFI CCNGG 2 cut(s) 35, 309
SetI ASST 3 cut(s) 209, 233, 370
SfaNI GCATC 2 cut(s) 97, 353
Sse9I AATT 1 cut(s) 184
SspMI CTAG 1 cut(s) 365
StyD4I CCNGG 2 cut(s) 33, 307
TaqI TCGA 1 cut(s) 315
TasI AATT 1 cut(s) 184
TfiI GAWTC 2 cut(s) 125, 289
TspDTI ATGAA 1 cut(s) 103
XapI RAATTY 1 cut(s) 184
XspI CTAG 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.