RchiOBHm_Chr4g0435271

Domain of unknown function (DUF4371)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000215
Physical Location & Seq
Reverse (-)
58896932 .. 58900647
3716 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40370

Sequence Viewer

Length: 768 bp
ATGCAAATTAGTGTTGCTATAGCTGAAGTAAAAGGTCTAATTGCTTGGCTTGATAAGTTTAGAGAAACTGGCTTCACAGATGCAATAATTACTGCTAAAGAAATTGCTGCTGCATTAGATGTTGATCCTGTTTTTCCTGAAAAGCGTCAAATTCAAAGAAAAAGATTTTTTGATGAAAGCGGCAGTAAGCCATCTCCATCATCTTCAAGTGAGGAATCTTTTAGACTACATTATTTCTTATATATTATAGATCAAGCTAAGGGGTCATTAAATAGAAGGTTTGAACAATACCAACGTTATGATGATATCTTTGGATTTTTATTCACTTCTGAAACTTTGAATTCCTTAAATGATAATGATTTGAAAGCTGCTTGTATTCATCTTGAGACTGTTTTGAGATATGGAGAGAGTTCAGATGTTGATGGGGAAGACATGTTTAGAGAGCTAAAACTCTTAAGGGAGATATTACCCAAACAGAAGATGACAGCTAGTGATATATTGAATTTCTTACTGGAAAGGAATACCTGCCCAGTTGTTAGACTTGCATATCGAATATTGTTAACTGTGCCTGTTACTGTTGCTTCAGCTGAGAGGAGTTTTTCCAAGTTAAAGTTATTGAAGTCTTATTTGCGATCAACTATGTCACAAGAAAGGCTAAATGGACTTGCTTTGATTTCGATTGAGAATGAATATCTTGGAAAAATCAATTGTGATAAGCTAATTGATCAGTTTGCAGGGAAGAAGGCAAGGAGATGGATTTTCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

255

Amino Acids

29.34

Weight (kDa)

8.63

Isoelectric Point (pI)

49.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimer_Tnp_hAT PF05699 157 - 230 7.7e-15 hAT family C-terminal dimerisation region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000215)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G35150 AT2G06500 AT2G16040 AT2G19960 AT2G19960 AT3G29638 AT3G29794 AT4G10200 AT4G10200 AT5G35475
fragaria_vesca FvH4_1g08455 FvH4_1g08761 FvH4_1g10851 FvH4_1g17271 FvH4_1g26762 FvH4_2g15031 FvH4_2g18762 FvH4_2g29241 FvH4_2g32571 FvH4_4g01531 FvH4_4g12942 FvH4_4g14421 FvH4_4g14431 FvH4_4g14434 FvH4_5g30891 FvH4_6g47641 FvH4_6g47642
malus_domestica MD01G1087700.v1.1 MD11G1104400.v1.1
pyrus_communis pycom05g13550 pycom11g18320
rosa_chinensis RchiOBHm_Chr1g0320361 RchiOBHm_Chr1g0321011 RchiOBHm_Chr1g0321921 RchiOBHm_Chr1g0377611 RchiOBHm_Chr1g0379061 RchiOBHm_Chr2g0106921 RchiOBHm_Chr2g0137341 RchiOBHm_Chr2g0139641 RchiOBHm_Chr2g0139651 RchiOBHm_Chr2g0144921 RchiOBHm_Chr2g0161851 RchiOBHm_Chr2g0172511 RchiOBHm_Chr3g0449931 RchiOBHm_Chr3g0452101 RchiOBHm_Chr3g0480551 RchiOBHm_Chr4g0427821 RchiOBHm_Chr4g0431861 RchiOBHm_Chr4g0435271 RchiOBHm_Chr5g0015121 RchiOBHm_Chr5g0031951 RchiOBHm_Chr5g0034331 RchiOBHm_Chr5g0059431 RchiOBHm_Chr6g0288531 RchiOBHm_Chr6g0308901 RchiOBHm_Chr7g0198801 RchiOBHm_Chr7g0198811 RchiOBHm_Chr7g0200001 RchiOBHm_Chr7g0205811 RchiOBHm_Chr7g0230921 RchiOBHm_Chr7g0233981
rosa_multiflora Rmu_sc0000475.1_g000004 Rmu_sc0000483.1_g000021 Rmu_sc0000551.1_g000007 Rmu_sc0000761.1_g000023 Rmu_sc0000898.1_g000072 Rmu_sc0001921.1_g000031 Rmu_sc0002804.1_g000009 Rmu_sc0002880.1_g000005 Rmu_sc0003207.1_g000046 Rmu_sc0003914.1_g000010 Rmu_sc0004165.1_g000089 Rmu_sc0004209.1_g000001 Rmu_sc0004402.1_g000017 Rmu_sc0004443.1_g000001 Rmu_sc0005506.1_g000007 Rmu_sc0005506.1_g000009 Rmu_sc0006443.1_g000001 Rmu_sc0008191.1_g000019 Rmu_sc0008328.1_g000004 Rmu_sc0009489.1_g000004 Rmu_sc0010368.1_g000012 Rmu_sc0010368.1_g000014 Rmu_sc0011232.1_g000005 Rmu_sc0011630.1_g000006 Rmu_sc0014780.1_g000001 Rmu_sc0028257.1_g000002 Rmu_sc0029902.1_g000001 Rmu_ssc0000386.1_g000041 Rmu_ssc0000434.1_g000020
rosa_roxburghii Rroxscaffold_2G00084750 Rroxscaffold_2G00090380 Rroxscaffold_2G00108310 Rroxscaffold_3G00235050 Rroxscaffold_3G00252220 Rroxscaffold_4G00323580 Rroxscaffold_5G00337920 Rroxscaffold_5G00370050 Rroxscaffold_7G00169180 Rroxscaffold_7G00200470
rosa_rugosa Rorug01G0156600.1 Rorug02G0305900 Rorug02G0362300 Rorug03G0111800 Rorug03G0273500 Rorug03G0340700 Rorug04G0196000 Rorug05G0251300 Rorug05G0465700 Rorug06G0031300 Rorug06G0170700 Rorug07G0226000 Rorug07G0263200
rosa_samantha Rh1CG203400 Rh1CG203500 Rh3AG212700 Rh3BG246300 Rh4BG318100 Rh6BG118800 Rh6DG105400 Rh7DG231500
rosa_wichuraiana Rw1G002740 Rw1G016740 Rw2G009190 Rw2G021330 Rw2G030170 Rw2G034650 Rw2G034990 Rw2G046190 Rw3G019490 Rw3G019500 Rw3G019510 Rw3G019990 Rw3G020480 Rw3G026090 Rw4G005490 Rw4G007090 Rw4G022920 Rw4G030140 Rw5G011030 Rw5G019330 Rw5G027260 Rw5G029990 Rw5G034080 Rw6G025080 Rw6G031390 Rw6G038690 Rw7G016630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 533
AciI CCGC 1 cut(s) 180
AclI AACGTT 1 cut(s) 295
AclWI GGATC 1 cut(s) 119
AcsI RAATTY 3 cut(s) 150, 340, 502
AcuI CTGAAG 2 cut(s) 45, 567
AflII CTTAAG 1 cut(s) 454
AflIII ACRYGT 1 cut(s) 432
AgsI TTSAA 8 cut(s) 155, 207, 284, 340, 364, 502, 619, 763
AluBI AGCT 7 cut(s) 23, 257, 368, 445, 488, 587, 718
AluI AGCT 7 cut(s) 23, 257, 368, 445, 488, 587, 718
Alw26I GTCTC 1 cut(s) 380
AlwI GGATC 1 cut(s) 119
ApeKI GCWGC 3 cut(s) 107, 110, 368
ApoI RAATTY 3 cut(s) 150, 340, 502
BbsI GAAGAC 1 cut(s) 435
BbvI GCAGC 3 cut(s) 94, 97, 355
BccI CCATC 4 cut(s) 199, 205, 416, 747
BclI TGATCA 1 cut(s) 724
BcoDI GTCTC 1 cut(s) 380
BfaI CTAG 1 cut(s) 489
BfmI CTRYAG 1 cut(s) 18
BfrI CTTAAG 1 cut(s) 454
BfuAI ACCTGC 1 cut(s) 533
BisI GCNGC 4 cut(s) 108, 111, 181, 369
BlsI GCNGC 4 cut(s) 109, 112, 182, 370
BmrI ACTGGG 1 cut(s) 524
BmsI GCATC 1 cut(s) 70
BmuI ACTGGG 1 cut(s) 524
BpiI GAAGAC 1 cut(s) 435
Bpu10I CCTNAGC 1 cut(s) 258
BpuEI CTTGAG 1 cut(s) 404
BsaBI GATNNNNATC 1 cut(s) 123
Bse1I ACTGG 3 cut(s) 73, 516, 530
Bse8I GATNNNNATC 1 cut(s) 123
BseJI GATNNNNATC 1 cut(s) 123
BseMII CTCAG 1 cut(s) 579
BseNI ACTGG 3 cut(s) 73, 516, 530
BseRI GAGGAG 1 cut(s) 607
BseXI GCAGC 3 cut(s) 94, 97, 355
BsmAI GTCTC 1 cut(s) 380
Bsp143I GATC 4 cut(s) 124, 250, 632, 724
BspACI CCGC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 580
BspMI ACCTGC 1 cut(s) 533
BspPI GGATC 1 cut(s) 119
BspTI CTTAAG 1 cut(s) 454
BsrI ACTGG 3 cut(s) 73, 516, 530
BssMI GATC 4 cut(s) 124, 250, 632, 724
Bst4CI ACNGT 3 cut(s) 391, 565, 577
BstAFI CTTAAG 1 cut(s) 454
BstDEI CTNAG 2 cut(s) 258, 588
BstKTI GATC 4 cut(s) 127, 253, 635, 727
BstMAI GTCTC 1 cut(s) 380
BstMBI GATC 4 cut(s) 124, 250, 632, 724
BstNSI RCATGY 1 cut(s) 436
BstSFI CTRYAG 1 cut(s) 18
BstV1I GCAGC 3 cut(s) 94, 97, 355
BstV2I GAAGAC 1 cut(s) 435
BveI ACCTGC 1 cut(s) 533
CseI GACGC 1 cut(s) 134
CviAII CATG 1 cut(s) 433
DdeI CTNAG 2 cut(s) 258, 588
DpnI GATC 4 cut(s) 126, 252, 634, 726
DpnII GATC 4 cut(s) 124, 250, 632, 724
Eco32I GATATC 1 cut(s) 307
Eco57I CTGAAG 2 cut(s) 45, 567
EcoRI GAATTC 1 cut(s) 340
EcoRV GATATC 1 cut(s) 307
FaeI CATG 1 cut(s) 436
FatI CATG 1 cut(s) 432
FbaI TGATCA 1 cut(s) 724
Fnu4HI GCNGC 4 cut(s) 108, 111, 181, 369
Fsp4HI GCNGC 4 cut(s) 108, 111, 181, 369
FspBI CTAG 1 cut(s) 489
GluI GCNGC 4 cut(s) 108, 111, 181, 369
HgaI GACGC 1 cut(s) 134
Hin1II CATG 1 cut(s) 436
HincII GTYRAC 1 cut(s) 561
HindII GTYRAC 1 cut(s) 561
HinfI GANTC 1 cut(s) 215
HpaI GTTAAC 1 cut(s) 561
Hpy166II GTNNAC 1 cut(s) 561
Hpy188I TCNGA 2 cut(s) 331, 415
Hpy188III TCNNGA 2 cut(s) 137, 383
Hpy8I GTNNAC 1 cut(s) 561
HpyAV CCTTC 2 cut(s) 270, 736
HpyCH4III ACNGT 3 cut(s) 391, 565, 577
HpyCH4IV ACGT 1 cut(s) 295
HpyCH4V TGCA 5 cut(s) 4, 83, 113, 545, 734
HpyF3I CTNAG 2 cut(s) 258, 588
HpySE526I ACGT 1 cut(s) 295
Hsp92II CATG 1 cut(s) 436
Ksp22I TGATCA 1 cut(s) 724
KspAI GTTAAC 1 cut(s) 561
Kzo9I GATC 4 cut(s) 124, 250, 632, 724
LpnPI CCDG 8 cut(s) 54, 141, 150, 497, 538, 543, 582, 720
Lsp1109I GCAGC 3 cut(s) 94, 97, 355
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 489
MaeII ACGT 1 cut(s) 295
MaeIII GTNAC 2 cut(s) 571, 642
MalI GATC 4 cut(s) 126, 252, 634, 726
MboI GATC 4 cut(s) 124, 250, 632, 724
MboII GAAGA 4 cut(s) 195, 440, 490, 751
MfeI CAATTG 1 cut(s) 706
MluCI AATT 9 cut(s) 6, 39, 87, 102, 150, 340, 502, 706, 720
MnlI CCTC 2 cut(s) 205, 585
MseI TTAA 5 cut(s) 269, 347, 455, 560, 608
MspA1I CMGCKG 1 cut(s) 587
MspCI CTTAAG 1 cut(s) 454
MunI CAATTG 1 cut(s) 706
NdeII GATC 4 cut(s) 124, 250, 632, 724
NlaIII CATG 1 cut(s) 436
NmuCI GTSAC 1 cut(s) 642
NspI RCATGY 1 cut(s) 436
PciI ACATGT 1 cut(s) 432
PfeI GAWTC 1 cut(s) 215
PkrI GCNGC 4 cut(s) 109, 112, 182, 370
PscI ACATGT 1 cut(s) 432
Psp1406I AACGTT 1 cut(s) 295
PvuII CAGCTG 1 cut(s) 587
SaqAI TTAA 5 cut(s) 269, 347, 455, 560, 608
SatI GCNGC 4 cut(s) 108, 111, 181, 369
Sau3AI GATC 4 cut(s) 124, 250, 632, 724
SfaNI GCATC 1 cut(s) 70
SfcI CTRYAG 1 cut(s) 18
SmlI CTYRAG 2 cut(s) 383, 454
SmoI CTYRAG 2 cut(s) 383, 454
Sse9I AATT 9 cut(s) 6, 39, 87, 102, 150, 340, 502, 706, 720
SsiI CCGC 1 cut(s) 180
SspI AATATT 1 cut(s) 555
SspMI CTAG 1 cut(s) 489
TaaI ACNGT 3 cut(s) 391, 565, 577
TaiI ACGT 1 cut(s) 298
TaqI TCGA 2 cut(s) 550, 677
TasI AATT 9 cut(s) 6, 39, 87, 102, 150, 340, 502, 706, 720
TauI GCSGC 1 cut(s) 183
TfiI GAWTC 1 cut(s) 215
Tru1I TTAA 5 cut(s) 269, 347, 455, 560, 608
Tru9I TTAA 5 cut(s) 269, 347, 455, 560, 608
TseFI GTSAC 1 cut(s) 642
TseI GCWGC 3 cut(s) 107, 110, 368
Tsp45I GTSAC 1 cut(s) 642
TspDTI ATGAA 3 cut(s) 189, 368, 702
Vha464I CTTAAG 1 cut(s) 454
XapI RAATTY 3 cut(s) 150, 340, 502
XceI RCATGY 1 cut(s) 436
XspI CTAG 1 cut(s) 489
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.