Rmu_sc0006443.1_g000001

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006443.1
OG0000215
Physical Location & Seq
Forward (+)
68 .. 424
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006443.1_g000001.1.cds

Sequence Viewer

Length: 357 bp
atggtaatttggtatcagttgctatatgcgatcaacactctgagtaaatgtcttcaagctgaaaatatggatattgatgctgctcttaaagaattaaatggacttattttttttcttgaagagtatagagaatccaggcttgatatggccatggatgaagctaaacaaatggcaagtgaattgggaattgaagctgtattccgtgaaaaacgcaccattcgaagaaagaagcagtttgatgacagtggcagtgatgaggtaatgcaattatctgaagaatcttttagagttaattccttcctctttataattgatcaagcccgttcttcacttcaaactcagttcgaacaattttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

118

Amino Acids

13.89

Weight (kDa)

4.62

Isoelectric Point (pI)

51.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000215)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G35150 AT2G06500 AT2G16040 AT2G19960 AT2G19960 AT3G29638 AT3G29794 AT4G10200 AT4G10200 AT5G35475
fragaria_vesca FvH4_1g08455 FvH4_1g08761 FvH4_1g10851 FvH4_1g17271 FvH4_1g26762 FvH4_2g15031 FvH4_2g18762 FvH4_2g29241 FvH4_2g32571 FvH4_4g01531 FvH4_4g12942 FvH4_4g14421 FvH4_4g14431 FvH4_4g14434 FvH4_5g30891 FvH4_6g47641 FvH4_6g47642
malus_domestica MD01G1087700.v1.1 MD11G1104400.v1.1
pyrus_communis pycom05g13550 pycom11g18320
rosa_chinensis RchiOBHm_Chr1g0320361 RchiOBHm_Chr1g0321011 RchiOBHm_Chr1g0321921 RchiOBHm_Chr1g0377611 RchiOBHm_Chr1g0379061 RchiOBHm_Chr2g0106921 RchiOBHm_Chr2g0137341 RchiOBHm_Chr2g0139641 RchiOBHm_Chr2g0139651 RchiOBHm_Chr2g0144921 RchiOBHm_Chr2g0161851 RchiOBHm_Chr2g0172511 RchiOBHm_Chr3g0449931 RchiOBHm_Chr3g0452101 RchiOBHm_Chr3g0480551 RchiOBHm_Chr4g0427821 RchiOBHm_Chr4g0431861 RchiOBHm_Chr4g0435271 RchiOBHm_Chr5g0015121 RchiOBHm_Chr5g0031951 RchiOBHm_Chr5g0034331 RchiOBHm_Chr5g0059431 RchiOBHm_Chr6g0288531 RchiOBHm_Chr6g0308901 RchiOBHm_Chr7g0198801 RchiOBHm_Chr7g0198811 RchiOBHm_Chr7g0200001 RchiOBHm_Chr7g0205811 RchiOBHm_Chr7g0230921 RchiOBHm_Chr7g0233981
rosa_multiflora Rmu_sc0000475.1_g000004 Rmu_sc0000483.1_g000021 Rmu_sc0000551.1_g000007 Rmu_sc0000761.1_g000023 Rmu_sc0000898.1_g000072 Rmu_sc0001921.1_g000031 Rmu_sc0002804.1_g000009 Rmu_sc0002880.1_g000005 Rmu_sc0003207.1_g000046 Rmu_sc0003914.1_g000010 Rmu_sc0004165.1_g000089 Rmu_sc0004209.1_g000001 Rmu_sc0004402.1_g000017 Rmu_sc0004443.1_g000001 Rmu_sc0005506.1_g000007 Rmu_sc0005506.1_g000009 Rmu_sc0006443.1_g000001 Rmu_sc0008191.1_g000019 Rmu_sc0008328.1_g000004 Rmu_sc0009489.1_g000004 Rmu_sc0010368.1_g000012 Rmu_sc0010368.1_g000014 Rmu_sc0011232.1_g000005 Rmu_sc0011630.1_g000006 Rmu_sc0014780.1_g000001 Rmu_sc0028257.1_g000002 Rmu_sc0029902.1_g000001 Rmu_ssc0000386.1_g000041 Rmu_ssc0000434.1_g000020
rosa_roxburghii Rroxscaffold_2G00084750 Rroxscaffold_2G00090380 Rroxscaffold_2G00108310 Rroxscaffold_3G00235050 Rroxscaffold_3G00252220 Rroxscaffold_4G00323580 Rroxscaffold_5G00337920 Rroxscaffold_5G00370050 Rroxscaffold_7G00169180 Rroxscaffold_7G00200470
rosa_rugosa Rorug01G0156600.1 Rorug02G0305900 Rorug02G0362300 Rorug03G0111800 Rorug03G0273500 Rorug03G0340700 Rorug04G0196000 Rorug05G0251300 Rorug05G0465700 Rorug06G0031300 Rorug06G0170700 Rorug07G0226000 Rorug07G0263200
rosa_samantha Rh1CG203400 Rh1CG203500 Rh3AG212700 Rh3BG246300 Rh4BG318100 Rh6BG118800 Rh6DG105400 Rh7DG231500
rosa_wichuraiana Rw1G002740 Rw1G016740 Rw2G009190 Rw2G021330 Rw2G030170 Rw2G034650 Rw2G034990 Rw2G046190 Rw3G019490 Rw3G019500 Rw3G019510 Rw3G019990 Rw3G020480 Rw3G026090 Rw4G005490 Rw4G007090 Rw4G022920 Rw4G030140 Rw5G011030 Rw5G019330 Rw5G027260 Rw5G029990 Rw5G034080 Rw6G025080 Rw6G031390 Rw6G038690 Rw7G016630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 308
AcoI YGGCCR 1 cut(s) 147
AcuI CTGAAG 1 cut(s) 294
AgsI TTSAA 4 cut(s) 56, 119, 191, 335
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 3 cut(s) 59, 161, 194
AluI AGCT 3 cut(s) 59, 161, 194
AoxI GGCC 1 cut(s) 147
ApeKI GCWGC 1 cut(s) 80
AsuII TTCGAA 2 cut(s) 220, 345
BalI TGGCCA 1 cut(s) 149
BbsI GAAGAC 1 cut(s) 44
BbvI GCAGC 1 cut(s) 67
BciT130I CCWGG 1 cut(s) 136
BclI TGATCA 1 cut(s) 313
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 136
BmsI GCATC 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 44
Bpu14I TTCGAA 2 cut(s) 220, 345
BsaJI CCNNGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 136
BseDI CCNNGG 1 cut(s) 150
BseGI GGATG 1 cut(s) 160
BseMII CTCAG 2 cut(s) 32, 353
BseXI GCAGC 1 cut(s) 67
BshFI GGCC 1 cut(s) 149
BsnI GGCC 1 cut(s) 149
Bsp119I TTCGAA 2 cut(s) 220, 345
Bsp143I GATC 2 cut(s) 30, 313
Bsp19I CCATGG 1 cut(s) 150
BspANI GGCC 1 cut(s) 149
BspCNI CTCAG 2 cut(s) 33, 352
BspT104I TTCGAA 2 cut(s) 220, 345
BssECI CCNNGG 1 cut(s) 150
BssMI GATC 2 cut(s) 30, 313
BssT1I CCWWGG 1 cut(s) 150
Bst2UI CCWGG 1 cut(s) 136
Bst4CI ACNGT 1 cut(s) 245
Bst6I CTCTTC 1 cut(s) 114
BstBI TTCGAA 2 cut(s) 220, 345
BstDEI CTNAG 2 cut(s) 41, 339
BstDSI CCRYGG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 2 cut(s) 33, 316
BstMBI GATC 2 cut(s) 30, 313
BstNI CCWGG 1 cut(s) 136
BstSCI CCNGG 1 cut(s) 134
BstV1I GCAGC 1 cut(s) 67
BstV2I GAAGAC 1 cut(s) 44
BsuRI GGCC 1 cut(s) 149
BtgI CCRYGG 1 cut(s) 150
BtsCI GGATG 1 cut(s) 160
BtsI GCAGTG 1 cut(s) 256
BtsIMutI CAGTG 2 cut(s) 250, 256
CviAII CATG 1 cut(s) 151
CviJI RGCY 6 cut(s) 59, 139, 149, 161, 194, 320
CviKI_1 RGCY 6 cut(s) 59, 139, 149, 161, 194, 320
DdeI CTNAG 2 cut(s) 41, 339
DpnI GATC 2 cut(s) 32, 315
DpnII GATC 2 cut(s) 30, 313
EaeI YGGCCR 1 cut(s) 147
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
Eco130I CCWWGG 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 294
EcoRII CCWGG 1 cut(s) 134
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 154
FaiI YATR 7 cut(s) 25, 27, 68, 126, 146, 152, 308
FatI CATG 1 cut(s) 150
FbaI TGATCA 1 cut(s) 313
Fnu4HI GCNGC 1 cut(s) 81
FokI GGATG 1 cut(s) 167
Fsp4HI GCNGC 1 cut(s) 81
GluI GCNGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 149
Hin1II CATG 1 cut(s) 154
HinfI GANTC 2 cut(s) 131, 278
Hpy188I TCNGA 2 cut(s) 42, 274
Hpy188III TCNNGA 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 307
HpyCH4III ACNGT 1 cut(s) 245
HpyCH4V TGCA 1 cut(s) 265
HpyF3I CTNAG 2 cut(s) 41, 339
Hsp92II CATG 1 cut(s) 154
Ksp22I TGATCA 1 cut(s) 313
Kzo9I GATC 2 cut(s) 30, 313
LpnPI CCDG 2 cut(s) 121, 148
Lsp1109I GCAGC 1 cut(s) 67
LweI GCATC 1 cut(s) 67
MalI GATC 2 cut(s) 32, 315
MboI GATC 2 cut(s) 30, 313
MboII GAAGA 5 cut(s) 44, 131, 234, 287, 318
MlsI TGGCCA 1 cut(s) 149
MluCI AATT 8 cut(s) 6, 92, 179, 186, 266, 292, 309, 350
MluNI TGGCCA 1 cut(s) 149
MnlI CCTC 2 cut(s) 250, 311
Mox20I TGGCCA 1 cut(s) 149
MscI TGGCCA 1 cut(s) 149
MseI TTAA 4 cut(s) 87, 95, 291, 355
Msp20I TGGCCA 1 cut(s) 149
MspR9I CCNGG 1 cut(s) 136
MvaI CCWGG 1 cut(s) 136
NcoI CCATGG 1 cut(s) 150
NdeII GATC 2 cut(s) 30, 313
NlaIII CATG 1 cut(s) 154
NspV TTCGAA 2 cut(s) 220, 345
PcsI WCGNNNNNNNCGW 1 cut(s) 217
PfeI GAWTC 2 cut(s) 131, 278
PkrI GCNGC 1 cut(s) 82
PsiI TTATAA 1 cut(s) 308
Psp6I CCWGG 1 cut(s) 134
PspGI CCWGG 1 cut(s) 134
SaqAI TTAA 4 cut(s) 87, 95, 291, 355
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 2 cut(s) 30, 313
ScrFI CCNGG 1 cut(s) 136
SetI ASST 4 cut(s) 61, 163, 196, 261
SfaNI GCATC 1 cut(s) 67
SfuI TTCGAA 2 cut(s) 220, 345
Sse9I AATT 8 cut(s) 6, 92, 179, 186, 266, 292, 309, 350
StyD4I CCNGG 1 cut(s) 134
StyI CCWWGG 1 cut(s) 150
TaaI ACNGT 1 cut(s) 245
TaqI TCGA 2 cut(s) 220, 345
TasI AATT 8 cut(s) 6, 92, 179, 186, 266, 292, 309, 350
TfiI GAWTC 2 cut(s) 131, 278
Tru1I TTAA 4 cut(s) 87, 95, 291, 355
Tru9I TTAA 4 cut(s) 87, 95, 291, 355
TscAI CASTG 2 cut(s) 250, 256
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 1 cut(s) 171
TspGWI ACGGA 1 cut(s) 191
TspRI CASTG 2 cut(s) 250, 256
XcmI CCANNNNNNNNNTGG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.