Rh1CG203500

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0000215
Physical Location & Seq
Forward (+)
44101885 .. 44102202
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG203500.1

Sequence Viewer

Length: 318 bp
ATGCTAAACAAAGATTTAGATAGAAAAGTAGAAACACCAATTGAAGTTCTGCACTTTGTTCAAAGATGTGATTGTTTCTCAAATACCATGATTGCTTATAGAATACTATTAACTATTCCTGTTACAGTTGCTTCTGCTGAAAGAAGCTTTTCAAAATTGAAACTAATAAAATCATATTTACGATCAACCATGTCACAAGAAAGATTGAATGGACTAGCCATGTTATCTATTGAAAGAAAATTGTTCAAAAAGTTTAAATACACTAACTTAATCAACATTTTTGCATCCCAAAAGGCAAGAAGAGTGATCTTCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

105

Amino Acids

12.32

Weight (kDa)

10.25

Isoelectric Point (pI)

37.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimer_Tnp_hAT PF05699 6 - 80 5.2e-16 hAT family C-terminal dimerisation region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000215)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G35150 AT2G06500 AT2G16040 AT2G19960 AT2G19960 AT3G29638 AT3G29794 AT4G10200 AT4G10200 AT5G35475
fragaria_vesca FvH4_1g08455 FvH4_1g08761 FvH4_1g10851 FvH4_1g17271 FvH4_1g26762 FvH4_2g15031 FvH4_2g18762 FvH4_2g29241 FvH4_2g32571 FvH4_4g01531 FvH4_4g12942 FvH4_4g14421 FvH4_4g14431 FvH4_4g14434 FvH4_5g30891 FvH4_6g47641 FvH4_6g47642
malus_domestica MD01G1087700.v1.1 MD11G1104400.v1.1
pyrus_communis pycom05g13550 pycom11g18320
rosa_chinensis RchiOBHm_Chr1g0320361 RchiOBHm_Chr1g0321011 RchiOBHm_Chr1g0321921 RchiOBHm_Chr1g0377611 RchiOBHm_Chr1g0379061 RchiOBHm_Chr2g0106921 RchiOBHm_Chr2g0137341 RchiOBHm_Chr2g0139641 RchiOBHm_Chr2g0139651 RchiOBHm_Chr2g0144921 RchiOBHm_Chr2g0161851 RchiOBHm_Chr2g0172511 RchiOBHm_Chr3g0449931 RchiOBHm_Chr3g0452101 RchiOBHm_Chr3g0480551 RchiOBHm_Chr4g0427821 RchiOBHm_Chr4g0431861 RchiOBHm_Chr4g0435271 RchiOBHm_Chr5g0015121 RchiOBHm_Chr5g0031951 RchiOBHm_Chr5g0034331 RchiOBHm_Chr5g0059431 RchiOBHm_Chr6g0288531 RchiOBHm_Chr6g0308901 RchiOBHm_Chr7g0198801 RchiOBHm_Chr7g0198811 RchiOBHm_Chr7g0200001 RchiOBHm_Chr7g0205811 RchiOBHm_Chr7g0230921 RchiOBHm_Chr7g0233981
rosa_multiflora Rmu_sc0000475.1_g000004 Rmu_sc0000483.1_g000021 Rmu_sc0000551.1_g000007 Rmu_sc0000761.1_g000023 Rmu_sc0000898.1_g000072 Rmu_sc0001921.1_g000031 Rmu_sc0002804.1_g000009 Rmu_sc0002880.1_g000005 Rmu_sc0003207.1_g000046 Rmu_sc0003914.1_g000010 Rmu_sc0004165.1_g000089 Rmu_sc0004209.1_g000001 Rmu_sc0004402.1_g000017 Rmu_sc0004443.1_g000001 Rmu_sc0005506.1_g000007 Rmu_sc0005506.1_g000009 Rmu_sc0006443.1_g000001 Rmu_sc0008191.1_g000019 Rmu_sc0008328.1_g000004 Rmu_sc0009489.1_g000004 Rmu_sc0010368.1_g000012 Rmu_sc0010368.1_g000014 Rmu_sc0011232.1_g000005 Rmu_sc0011630.1_g000006 Rmu_sc0014780.1_g000001 Rmu_sc0028257.1_g000002 Rmu_sc0029902.1_g000001 Rmu_ssc0000386.1_g000041 Rmu_ssc0000434.1_g000020
rosa_roxburghii Rroxscaffold_2G00084750 Rroxscaffold_2G00090380 Rroxscaffold_2G00108310 Rroxscaffold_3G00235050 Rroxscaffold_3G00252220 Rroxscaffold_4G00323580 Rroxscaffold_5G00337920 Rroxscaffold_5G00370050 Rroxscaffold_7G00169180 Rroxscaffold_7G00200470
rosa_rugosa Rorug01G0156600.1 Rorug02G0305900 Rorug02G0362300 Rorug03G0111800 Rorug03G0273500 Rorug03G0340700 Rorug04G0196000 Rorug05G0251300 Rorug05G0465700 Rorug06G0031300 Rorug06G0170700 Rorug07G0226000 Rorug07G0263200
rosa_samantha Rh1CG203400 Rh1CG203500 Rh3AG212700 Rh3BG246300 Rh4BG318100 Rh6BG118800 Rh6DG105400 Rh7DG231500
rosa_wichuraiana Rw1G002740 Rw1G016740 Rw2G009190 Rw2G021330 Rw2G030170 Rw2G034650 Rw2G034990 Rw2G046190 Rw3G019490 Rw3G019500 Rw3G019510 Rw3G019990 Rw3G020480 Rw3G026090 Rw4G005490 Rw4G007090 Rw4G022920 Rw4G030140 Rw5G011030 Rw5G019330 Rw5G027260 Rw5G029990 Rw5G034080 Rw6G025080 Rw6G031390 Rw6G038690 Rw7G016630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 8 cut(s) 44, 62, 153, 160, 208, 233, 247, 313
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
Asp700I GAANNNNTTC 1 cut(s) 148
BfaI CTAG 1 cut(s) 215
BmsI GCATC 1 cut(s) 293
BseGI GGATG 1 cut(s) 284
BsgI GTGCAG 1 cut(s) 35
Bsp143I GATC 2 cut(s) 182, 306
BssMI GATC 2 cut(s) 182, 306
Bst4CI ACNGT 1 cut(s) 127
Bst6I CTCTTC 1 cut(s) 295
BstF5I GGATG 1 cut(s) 284
BstKTI GATC 2 cut(s) 185, 309
BstMBI GATC 2 cut(s) 182, 306
BtsCI GGATG 1 cut(s) 284
CviAII CATG 3 cut(s) 88, 190, 220
CviJI RGCY 2 cut(s) 147, 218
CviKI_1 RGCY 2 cut(s) 147, 218
DpnI GATC 2 cut(s) 184, 308
DpnII GATC 2 cut(s) 182, 306
DraI TTTAAA 1 cut(s) 256
Eam1104I CTCTTC 1 cut(s) 295
EarI CTCTTC 1 cut(s) 295
FaeI CATG 3 cut(s) 91, 193, 223
FaiI YATR 5 cut(s) 89, 99, 175, 191, 221
FatI CATG 3 cut(s) 87, 189, 219
FokI GGATG 1 cut(s) 271
FspBI CTAG 1 cut(s) 215
FspEI CC 9 cut(s) 51, 100, 132, 195, 202, 232, 278, 301, 302
Hin1II CATG 3 cut(s) 91, 193, 223
HindIII AAGCTT 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 2 cut(s) 52, 284
Hsp92II CATG 3 cut(s) 91, 193, 223
Kzo9I GATC 2 cut(s) 182, 306
LpnPI CCDG 1 cut(s) 132
LweI GCATC 1 cut(s) 293
MaeI CTAG 1 cut(s) 215
MaeIII GTNAC 2 cut(s) 121, 192
MalI GATC 2 cut(s) 184, 308
MboI GATC 2 cut(s) 182, 306
MboII GAAGA 2 cut(s) 301, 312
MfeI CAATTG 1 cut(s) 39
MluCI AATT 3 cut(s) 39, 155, 239
MroXI GAANNNNTTC 1 cut(s) 148
MseI TTAA 3 cut(s) 110, 255, 269
MunI CAATTG 1 cut(s) 39
NdeII GATC 2 cut(s) 182, 306
NlaIII CATG 3 cut(s) 91, 193, 223
NmuCI GTSAC 1 cut(s) 192
PdmI GAANNNNTTC 1 cut(s) 148
SaqAI TTAA 3 cut(s) 110, 255, 269
Sau3AI GATC 2 cut(s) 182, 306
SetI ASST 1 cut(s) 149
SfaNI GCATC 1 cut(s) 293
SgeI CNNG 7 cut(s) 100, 131, 202, 209, 227, 232, 309
Sse9I AATT 3 cut(s) 39, 155, 239
SspMI CTAG 1 cut(s) 215
TaaI ACNGT 1 cut(s) 127
TasI AATT 3 cut(s) 39, 155, 239
Tru1I TTAA 3 cut(s) 110, 255, 269
Tru9I TTAA 3 cut(s) 110, 255, 269
TseFI GTSAC 1 cut(s) 192
Tsp45I GTSAC 1 cut(s) 192
XmnI GAANNNNTTC 1 cut(s) 148
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.