Rmu_sc0004209.1_g000001

DNA-binding transcription factor activity, RNA polymerase II-specific

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004209.1
Physical Location & Seq
Reverse (-)
1 .. 5769
5769 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004209.1_g000001.1.cds

Sequence Viewer

Length: 1479 bp
atgctacgaacaaaaacaatcaaagatgaaggcttaagaagttacttaaccacaagcttcttgctcgcgaccacgagccagcatattctgaacgacgttctggaagaagatgaggacaaccggagctggaggagaaaccaaagaaggaggtcgcctacggggaacaatctgaagaagaagcgtcaccgatcgatgtgcttgccggtcgccggaaaagagaagcaaaagagagatgcgttagttaagattcaagctggatctcttagtaagtacttcaacacaaataataaacaagcacagacttcagctggtccaaaaatacgtgagaatgagaatgagaaggatgttgaagaacatgatcagttaatgaaggaaaatgagagtgcagaatcaagtcaaggtcttaatgccaatgaaaatgatgatattagtcagcctataaatgatagtgttggtacggacgaaccaaatcttccagtgaatgaggaagaaaatatcattgttgaagatgatcaaaacaaagattcaagtgcaaaatttgactttccatttgaggttgatgatccaggaaattgggataagattaaacaaaatgtcagagattttttagtcgaaagagatcctaaaagagagaatgatcttacctttccggttgatgacttggggagacatttcagtcccacacattattttcgtgtctttcctaatggtgaaaagaagaacaggaggtggttgatttactcagtttcgttagacaaggtattttgcttttgttgtaaattgttcaagcaagaccacaacaagactttattgggtcaatttgctaatgaaggattgaatgattggaaaaatatgagtgcaaggcttgcaagccatgaaagaaatagtcaacacatcagttgctttactagttggattgaactggaaacaagattgaaaaagaatgcaacaattgatcaagctgtggaagaacaaataaagaaggagagagaacattggagacaggtactcttgagaatcctaactgttgtgaaaagactttcgaaaaataatttggcatttcgtggggataatgagaaagtgtatgagaagaagaatgggattttcttacaagtaattgagatgattgctgaatttgatccgctattagcaaatgaggtaaaaacttccatcattgcaacgatcaaagaagcaaagtacttttcagttatacttgattgcactccagatgcaagtgatgaggaacaaatgtctagtgttgtctgttgtgttgatgttacagcaagtccgattgtggtaagagaattatttttggaatttttaacggtggatgatacatcggggcttggactgtttaatgagcttgtaaatgcactgaacactcttacacttgatattggtgatatacgaggacagggatatgacaatggctctaatatgagaggaaaacataagggtgtgcagaagagacttcttgag

Protein Analysis

493

Amino Acids

56.69

Weight (kDa)

5.76

Isoelectric Point (pI)

48.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000215)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G35150 AT2G06500 AT2G16040 AT2G19960 AT2G19960 AT3G29638 AT3G29794 AT4G10200 AT4G10200 AT5G35475
fragaria_vesca FvH4_1g08455 FvH4_1g08761 FvH4_1g10851 FvH4_1g17271 FvH4_1g26762 FvH4_2g15031 FvH4_2g18762 FvH4_2g29241 FvH4_2g32571 FvH4_4g01531 FvH4_4g12942 FvH4_4g14421 FvH4_4g14431 FvH4_4g14434 FvH4_5g30891 FvH4_6g47641 FvH4_6g47642
malus_domestica MD01G1087700.v1.1 MD11G1104400.v1.1
pyrus_communis pycom05g13550 pycom11g18320
rosa_chinensis RchiOBHm_Chr1g0320361 RchiOBHm_Chr1g0321011 RchiOBHm_Chr1g0321921 RchiOBHm_Chr1g0377611 RchiOBHm_Chr1g0379061 RchiOBHm_Chr2g0106921 RchiOBHm_Chr2g0137341 RchiOBHm_Chr2g0139641 RchiOBHm_Chr2g0139651 RchiOBHm_Chr2g0144921 RchiOBHm_Chr2g0161851 RchiOBHm_Chr2g0172511 RchiOBHm_Chr3g0449931 RchiOBHm_Chr3g0452101 RchiOBHm_Chr3g0480551 RchiOBHm_Chr4g0427821 RchiOBHm_Chr4g0431861 RchiOBHm_Chr4g0435271 RchiOBHm_Chr5g0015121 RchiOBHm_Chr5g0031951 RchiOBHm_Chr5g0034331 RchiOBHm_Chr5g0059431 RchiOBHm_Chr6g0288531 RchiOBHm_Chr6g0308901 RchiOBHm_Chr7g0198801 RchiOBHm_Chr7g0198811 RchiOBHm_Chr7g0200001 RchiOBHm_Chr7g0205811 RchiOBHm_Chr7g0230921 RchiOBHm_Chr7g0233981
rosa_multiflora Rmu_sc0000475.1_g000004 Rmu_sc0000483.1_g000021 Rmu_sc0000551.1_g000007 Rmu_sc0000761.1_g000023 Rmu_sc0000898.1_g000072 Rmu_sc0001921.1_g000031 Rmu_sc0002804.1_g000009 Rmu_sc0002880.1_g000005 Rmu_sc0003207.1_g000046 Rmu_sc0003914.1_g000010 Rmu_sc0004165.1_g000089 Rmu_sc0004209.1_g000001 Rmu_sc0004402.1_g000017 Rmu_sc0004443.1_g000001 Rmu_sc0005506.1_g000007 Rmu_sc0005506.1_g000009 Rmu_sc0006443.1_g000001 Rmu_sc0008191.1_g000019 Rmu_sc0008328.1_g000004 Rmu_sc0009489.1_g000004 Rmu_sc0010368.1_g000012 Rmu_sc0010368.1_g000014 Rmu_sc0011232.1_g000005 Rmu_sc0011630.1_g000006 Rmu_sc0014780.1_g000001 Rmu_sc0028257.1_g000002 Rmu_sc0029902.1_g000001 Rmu_ssc0000386.1_g000041 Rmu_ssc0000434.1_g000020
rosa_roxburghii Rroxscaffold_2G00084750 Rroxscaffold_2G00090380 Rroxscaffold_2G00108310 Rroxscaffold_3G00235050 Rroxscaffold_3G00252220 Rroxscaffold_4G00323580 Rroxscaffold_5G00337920 Rroxscaffold_5G00370050 Rroxscaffold_7G00169180 Rroxscaffold_7G00200470
rosa_rugosa Rorug01G0156600.1 Rorug02G0305900 Rorug02G0362300 Rorug03G0111800 Rorug03G0273500 Rorug03G0340700 Rorug04G0196000 Rorug05G0251300 Rorug05G0465700 Rorug06G0031300 Rorug06G0170700 Rorug07G0226000 Rorug07G0263200
rosa_samantha Rh1CG203400 Rh1CG203500 Rh3AG212700 Rh3BG246300 Rh4BG318100 Rh6BG118800 Rh6DG105400 Rh7DG231500
rosa_wichuraiana Rw1G002740 Rw1G016740 Rw2G009190 Rw2G021330 Rw2G030170 Rw2G034650 Rw2G034990 Rw2G046190 Rw3G019490 Rw3G019500 Rw3G019510 Rw3G019990 Rw3G020480 Rw3G026090 Rw4G005490 Rw4G007090 Rw4G022920 Rw4G030140 Rw5G011030 Rw5G019330 Rw5G027260 Rw5G029990 Rw5G034080 Rw6G025080 Rw6G031390 Rw6G038690 Rw7G016630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 675
AccII CGCG 1 cut(s) 68
AciI CCGC 1 cut(s) 1142
AclWI GGATC 4 cut(s) 265, 557, 614, 1133
AcsI RAATTY 3 cut(s) 536, 1133, 1316
AcuI CTGAAG 2 cut(s) 191, 288
AfaI GTAC 4 cut(s) 272, 457, 1008, 1199
AfiI CCNNNNNNNGG 1 cut(s) 209
AflII CTTAAG 1 cut(s) 34
AgsI TTSAA 9 cut(s) 251, 277, 350, 506, 528, 787, 838, 920, 937
AhlI ACTAGT 1 cut(s) 908
AjnI CCWGG 1 cut(s) 565
AjuI GAANNNNNNNTTGG 2 cut(s) 1037, 1069
AluBI AGCT 6 cut(s) 57, 126, 254, 308, 962, 1363
AluI AGCT 6 cut(s) 57, 126, 254, 308, 962, 1363
Alw26I GTCTC 3 cut(s) 661, 994, 1462
AlwI GGATC 4 cut(s) 265, 557, 614, 1133
ApoI RAATTY 3 cut(s) 536, 1133, 1316
ArsI GACNNNNNNTTYG 2 cut(s) 533, 565
AspS9I GGNCC 1 cut(s) 311
AsuHPI GGTGA 3 cut(s) 176, 722, 1412
AsuII TTCGAA 1 cut(s) 1043
AvaII GGWCC 1 cut(s) 311
BauI CACGAG 1 cut(s) 73
BccI CCATC 1 cut(s) 1178
BcgI CGANNNNNNTGC 4 cut(s) 177, 181, 211, 215
BciT130I CCWGG 1 cut(s) 567
BclI TGATCA 3 cut(s) 358, 511, 955
BcoDI GTCTC 3 cut(s) 661, 994, 1462
BcuI ACTAGT 1 cut(s) 908
BfaI CTAG 2 cut(s) 909, 1254
BfrI CTTAAG 1 cut(s) 34
BmcAI AGTACT 2 cut(s) 272, 1199
Bme1390I CCNGG 1 cut(s) 567
Bme18I GGWCC 1 cut(s) 311
BmgT120I GGNCC 1 cut(s) 311
BmrFI CCNGG 1 cut(s) 567
BmsI GCATC 2 cut(s) 223, 1219
BpmI CTGGAG 2 cut(s) 148, 1209
Bpu14I TTCGAA 1 cut(s) 1043
BpuEI CTTGAG 1 cut(s) 1033
Bsa29I ATCGAT 1 cut(s) 191
BsaAI YACGTR 1 cut(s) 323
BsaWI WCCGGW 2 cut(s) 120, 649
Bsc4I CCNNNNNNNGG 1 cut(s) 209
Bse118I RCCGGY 1 cut(s) 202
Bse1I ACTGG 2 cut(s) 476, 927
Bse3DI GCAATG 1 cut(s) 1173
BseBI CCWGG 1 cut(s) 567
BseCI ATCGAT 1 cut(s) 191
BseGI GGATG 2 cut(s) 349, 1336
BseLI CCNNNNNNNGG 1 cut(s) 209
BseMI GCAATG 1 cut(s) 1173
BseMII CTCAG 1 cut(s) 756
BseNI ACTGG 2 cut(s) 476, 927
BseRI GAGGAG 1 cut(s) 145
BsgI GTGCAG 1 cut(s) 405
Bsh1236I CGCG 1 cut(s) 68
Bsh1285I CGRYCG 2 cut(s) 191, 207
BshVI ATCGAT 1 cut(s) 191
BsiEI CGRYCG 2 cut(s) 191, 207
BsiSI CCGG 4 cut(s) 121, 203, 210, 650
BslFI GGGAC 1 cut(s) 663
BslI CCNNNNNNNGG 1 cut(s) 209
BsmAI GTCTC 3 cut(s) 661, 994, 1462
BsmFI GGGAC 1 cut(s) 663
BsmI GAATGC 1 cut(s) 949
Bsp119I TTCGAA 1 cut(s) 1043
Bsp68I TCGCGA 1 cut(s) 68
BspACI CCGC 1 cut(s) 1142
BspCNI CTCAG 1 cut(s) 755
BspDI ATCGAT 1 cut(s) 191
BspFNI CGCG 1 cut(s) 68
BspPI GGATC 4 cut(s) 265, 557, 614, 1133
BspT104I TTCGAA 1 cut(s) 1043
BspTI CTTAAG 1 cut(s) 34
BsrDI GCAATG 1 cut(s) 1173
BsrFI RCCGGY 1 cut(s) 202
BsrI ACTGG 2 cut(s) 476, 927
BssAI RCCGGY 1 cut(s) 202
BssSI CACGAG 1 cut(s) 73
Bst2BI CACGAG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 567
Bst4CI ACNGT 3 cut(s) 1027, 1327, 1353
Bst6I CTCTTC 1 cut(s) 1460
BstAFI CTTAAG 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 866
BstBAI YACGTR 1 cut(s) 323
BstBI TTCGAA 1 cut(s) 1043
BstC8I GCNNGC 5 cut(s) 66, 80, 200, 867, 871
BstDEI CTNAG 2 cut(s) 263, 742
BstF5I GGATG 2 cut(s) 349, 1336
BstFNI CGCG 1 cut(s) 68
BstMAI GTCTC 3 cut(s) 661, 994, 1462
BstMCI CGRYCG 2 cut(s) 191, 207
BstMWI GCNNNNNNNGC 1 cut(s) 866
BstNI CCWGG 1 cut(s) 567
BstSCI CCNGG 1 cut(s) 565
BstUI CGCG 1 cut(s) 68
BstX2I RGATCY 2 cut(s) 257, 619
BstXI CCANNNNNNTGG 1 cut(s) 573
BstYI RGATCY 2 cut(s) 257, 619
Bsu15I ATCGAT 1 cut(s) 191
BsuTUI ATCGAT 1 cut(s) 191
BtsCI GGATG 2 cut(s) 349, 1336
BtsIMutI CAGTG 2 cut(s) 483, 1373
BtuMI TCGCGA 1 cut(s) 68
Cac8I GCNNGC 5 cut(s) 66, 80, 200, 867, 871
Cfr10I RCCGGY 1 cut(s) 202
Cfr13I GGNCC 1 cut(s) 311
ClaI ATCGAT 1 cut(s) 191
CseI GACGC 1 cut(s) 170
Csp6I GTAC 4 cut(s) 271, 456, 1007, 1198
CviAII CATG 2 cut(s) 356, 875
CviQI GTAC 4 cut(s) 271, 456, 1007, 1198
DdeI CTNAG 2 cut(s) 263, 742
DrdI GACNNNNNNGTC 1 cut(s) 675
DseDI GACNNNNNNGTC 1 cut(s) 675
Eam1104I CTCTTC 1 cut(s) 1460
EarI CTCTTC 1 cut(s) 1460
Eco47I GGWCC 1 cut(s) 311
Eco57I CTGAAG 2 cut(s) 191, 288
EcoRII CCWGG 1 cut(s) 565
FaeI CATG 2 cut(s) 359, 878
FaqI GGGAC 1 cut(s) 663
FatI CATG 2 cut(s) 355, 874
FbaI TGATCA 3 cut(s) 358, 511, 955
FokI GGATG 2 cut(s) 356, 1343
FspBI CTAG 2 cut(s) 909, 1254
GsuI CTGGAG 2 cut(s) 148, 1209
HapII CCGG 4 cut(s) 121, 203, 210, 650
HgaI GACGC 1 cut(s) 170
Hin1II CATG 2 cut(s) 359, 878
HincII GTYRAC 1 cut(s) 890
HindII GTYRAC 1 cut(s) 890
HindIII AAGCTT 1 cut(s) 55
HinfI GANTC 4 cut(s) 247, 389, 524, 1017
HpaII CCGG 4 cut(s) 121, 203, 210, 650
HphI GGTGA 3 cut(s) 176, 722, 1412
Hpy166II GTNNAC 1 cut(s) 890
Hpy188I TCNGA 4 cut(s) 90, 171, 599, 1290
Hpy188III TCNNGA 5 cut(s) 67, 101, 1012, 1226, 1475
Hpy8I GTNNAC 1 cut(s) 890
Hpy99I CGWCG 1 cut(s) 98
HpyAV CCTTC 6 cut(s) 23, 138, 334, 364, 824, 976
HpyCH4III ACNGT 3 cut(s) 1027, 1327, 1353
HpyCH4IV ACGT 2 cut(s) 96, 322
HpyF10VI GCNNNNNNNGC 1 cut(s) 866
HpyF3I CTNAG 2 cut(s) 263, 742
HpySE526I ACGT 2 cut(s) 96, 322
Hsp92II CATG 2 cut(s) 359, 878
Ksp22I TGATCA 3 cut(s) 358, 511, 955
LmnI GCTCC 1 cut(s) 123
LweI GCATC 2 cut(s) 223, 1219
MaeI CTAG 2 cut(s) 909, 1254
MaeII ACGT 2 cut(s) 96, 322
MaeIII GTNAC 3 cut(s) 41, 182, 1276
MfeI CAATTG 1 cut(s) 951
MflI RGATCY 2 cut(s) 257, 619
MmeI TCCRAC 1 cut(s) 893
MseI TTAA 8 cut(s) 35, 47, 243, 365, 405, 585, 1322, 1356
MslI CAYNNNNRTG 1 cut(s) 1455
MspA1I CMGCKG 1 cut(s) 308
MspCI CTTAAG 1 cut(s) 34
MspI CCGG 4 cut(s) 121, 203, 210, 650
MspR9I CCNGG 1 cut(s) 567
MunI CAATTG 1 cut(s) 951
Mva1269I GAATGC 1 cut(s) 949
MvaI CCWGG 1 cut(s) 567
MvnI CGCG 1 cut(s) 68
MwoI GCNNNNNNNGC 1 cut(s) 866
NlaIII CATG 2 cut(s) 359, 878
NmuCI GTSAC 1 cut(s) 182
NruI TCGCGA 1 cut(s) 68
NspV TTCGAA 1 cut(s) 1043
PctI GAATGC 1 cut(s) 949
PfeI GAWTC 4 cut(s) 247, 389, 524, 1017
PfoI TCCNGGA 1 cut(s) 565
Ple19I CGATCG 1 cut(s) 191
Ppu21I YACGTR 1 cut(s) 323
Psp6I CCWGG 1 cut(s) 565
PspGI CCWGG 1 cut(s) 565
PspPI GGNCC 1 cut(s) 311
PsuI RGATCY 2 cut(s) 257, 619
PvuI CGATCG 1 cut(s) 191
PvuII CAGCTG 1 cut(s) 308
RruI TCGCGA 1 cut(s) 68
RsaI GTAC 4 cut(s) 272, 457, 1008, 1199
RsaNI GTAC 4 cut(s) 271, 456, 1007, 1198
RseI CAYNNNNRTG 1 cut(s) 1455
SaqAI TTAA 8 cut(s) 35, 47, 243, 365, 405, 585, 1322, 1356
Sau96I GGNCC 1 cut(s) 311
ScaI AGTACT 2 cut(s) 272, 1199
ScrFI CCNGG 1 cut(s) 567
SfaNI GCATC 2 cut(s) 223, 1219
SfuI TTCGAA 1 cut(s) 1043
SinI GGWCC 1 cut(s) 311
SmiMI CAYNNNNRTG 1 cut(s) 1455
SmlI CTYRAG 3 cut(s) 34, 1012, 1475
SmoI CTYRAG 3 cut(s) 34, 1012, 1475
SpeI ACTAGT 1 cut(s) 908
SsiI CCGC 1 cut(s) 1142
SspMI CTAG 2 cut(s) 909, 1254
StyD4I CCNGG 1 cut(s) 565
TaaI ACNGT 3 cut(s) 1027, 1327, 1353
TaiI ACGT 2 cut(s) 99, 325
TaqI TCGA 3 cut(s) 191, 612, 1043
TatI WGTACW 2 cut(s) 270, 1197
TfiI GAWTC 4 cut(s) 247, 389, 524, 1017
Tru1I TTAA 8 cut(s) 35, 47, 243, 365, 405, 585, 1322, 1356
Tru9I TTAA 8 cut(s) 35, 47, 243, 365, 405, 585, 1322, 1356
TscAI CASTG 2 cut(s) 483, 1380
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 5 cut(s) 42, 383, 429, 843, 891
TspGWI ACGGA 1 cut(s) 473
TspRI CASTG 2 cut(s) 483, 1380
Vha464I CTTAAG 1 cut(s) 34
VpaK11BI GGWCC 1 cut(s) 311
XapI RAATTY 3 cut(s) 536, 1133, 1316
XspI CTAG 2 cut(s) 909, 1254
ZrmI AGTACT 2 cut(s) 272, 1199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.