Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8138254.1

Orthogroup ID

OG0000132

Physical Location & Seq

Genomic Coordinates Reverse (-)

237 .. 536

Gene Structure 300 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8138254.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ctggcaagagatccagaacaatggggggatgatgctgattcctttaagccagagaggttcctccatgactctatgactgccaaaatcgacttcagagggaataactttgagctcttaccctttggggccggtcgaagaatatgtccgggcatgtcatttgccaatgcagtgattgagctaactcttttccaattgctctaccgctttgattgggaactggctgatgggataaaaccagatgaactagacatgactgagagttggggagcaacatgccacccctcatggctgatgggataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0005575 GO:0008150 GO:0008152 GO:0009058 GO:0016020 GO:0016491 GO:0016705 GO:0016709 GO:0019748 GO:0044550 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00140 ko00380 ko00590 ko00591 ko00830 ko00980 ko01100 ko04212 ko04726 ko04750 ko04913 ko04917 ko04927 ko04934 ko05204 map00140 map00380 map00590 map00591 map00830 map00980 map01100 map04212 map04726 map04750 map04913 map04917 map04927 map04934 map05204

Pfam Domains

Protein Families

p450

Protein Analysis

99

Amino Acids

11.33

Weight (kDa)

4.49

Isoelectric Point (pI)

32.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000132)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g03210 FvH4_3g24170 FvH4_3g24171 FvH4_6g02110 FvH4_6g02110 FvH4_6g21500 FvH4_6g44530 FvH4_6g44700 FvH4_6g44700 FvH4_6g44710 FvH4_6g44730 FvH4_6g44750 FvH4_6g44751 FvH4_6g44751 FvH4_6g53570
malus_domestica	MD00G1138500.v1.1 MD00G1138600.v1.1 MD00G1138700.v1.1 MD00G1153200.v1.1 MD00G1153300.v1.1 MD00G1153400.v1.1 MD00G1153500.v1.1 MD00G1153600.v1.1 MD00G1153800.v1.1 MD00G1153900.v1.1 MD00G1154000.v1.1 MD03G1187300.v1.1 MD04G1245500.v1.1 MD11G1202200.v1.1 MD11G1202300.v1.1 MD11G1202500.v1.1 MD14G1096600.v1.1 MD14G1096700.v1.1 MD17G1000100.v1.1 MD17G1000200.v1.1 MD17G1000300.v1.1
prunus_persica	Prupe.1G492000_v2.0.a1 Prupe.1G492100_v2.0.a1 Prupe.2G073800_v2.0.a1 Prupe.2G073900_v2.0.a1 Prupe.2G074300_v2.0.a1 Prupe.3G306800_v2.0.a1 Prupe.4G237900_v2.0.a1 Prupe.4G238000_v2.0.a1 Prupe.4G238200_v2.0.a1 Prupe.4G238300_v2.0.a1 Prupe.4G238600_v2.0.a1 Prupe.4G239200_v2.0.a1 Prupe.4G239300_v2.0.a1
pyrus_communis	pycom03g13950 pycom03g14010 pycom04g21620 pycom04g21630 pycom111g00820 pycom11g17490 pycom11g17500 pycom17g00860 pycom17g00880
rosa_chinensis	RchiOBHm_Chr1g0325151 RchiOBHm_Chr1g0329431 RchiOBHm_Chr1g0334551 RchiOBHm_Chr1g0334561 RchiOBHm_Chr1g0336531 RchiOBHm_Chr1g0336541 RchiOBHm_Chr2g0175621 RchiOBHm_Chr2g0175641 RchiOBHm_Chr2g0175651 RchiOBHm_Chr2g0175701 RchiOBHm_Chr2g0175711 RchiOBHm_Chr3g0447771 RchiOBHm_Chr3g0447781 RchiOBHm_Chr3g0447791 RchiOBHm_Chr3g0447801 RchiOBHm_Chr5g0043061 RchiOBHm_Chr5g0043071 RchiOBHm_Chr5g0043221 RchiOBHm_Chr5g0043231 RchiOBHm_Chr5g0043921 RchiOBHm_Chr5g0054481 RchiOBHm_Chr5g0054491 RchiOBHm_Chr5g0054511 RchiOBHm_Chr5g0054551 RchiOBHm_Chr5g0054561 RchiOBHm_Chr5g0054581 RchiOBHm_Chr6g0296341
rosa_laevigata	RLG00000011704 RLG00000022344 RLG00000022345 RLG00000022350 RLG00000022351 RLG00000025970 RLG00000025971 RLG00000025972 RLG00000029355 RLG00000029356 RLG00000029886 RLG00000030155 RLG00000034172 RLG00000034938
rosa_multiflora	Rmu_co8138254.1_g000001 Rmu_co8268883.1_g000001 Rmu_co8271167.1_g000001 Rmu_co8294571.1_g000001 Rmu_co8350865.1_g000001 Rmu_co8364355.1_g000001 Rmu_co8416839.1_g000001 Rmu_sc0000698.1_g000089 Rmu_sc0000698.1_g000146 Rmu_sc0000998.1_g000014 Rmu_sc0000998.1_g000015 Rmu_sc0000998.1_g000020 Rmu_sc0000998.1_g000021 Rmu_sc0001478.1_g000005 Rmu_sc0001654.1_g000011 Rmu_sc0001981.1_g000002 Rmu_sc0002655.1_g000005 Rmu_sc0002655.1_g000011 Rmu_sc0002655.1_g000018 Rmu_sc0005044.1_g000025 Rmu_sc0005591.1_g000001 Rmu_sc0007742.1_g000012 Rmu_sc0008148.1_g000071 Rmu_sc0009324.1_g000003 Rmu_sc0009324.1_g000004 Rmu_sc0009324.1_g000005 Rmu_sc0014424.1_g000003 Rmu_sc0019317.1_g000001 Rmu_sc0027639.1_g000001
rosa_roxburghii	Rroxscaffold_1G00026360 Rroxscaffold_1G00026400 Rroxscaffold_1G00037560 Rroxscaffold_2G00077140 Rroxscaffold_2G00077180 Rroxscaffold_4G00315510 Rroxscaffold_4G00315520 Rroxscaffold_4G00324880 Rroxscaffold_6G00425980 Rroxscaffold_6G00425990 Rroxscaffold_7G00171610 Rroxscaffold_7G00178470 Rroxscaffold_7G00178490
rosa_rugosa	Rorug01G0050000 Rorug01G0079800 Rorug01G0126000 Rorug01G0126400 Rorug02G0586700 Rorug02G0586700 Rorug02G0586800 Rorug02G0587000 Rorug02G0605600 Rorug02G0605700 Rorug05G0123000 Rorug05G0204600 Rorug05G0204800 Rorug05G0209100 Rorug05G0286600 Rorug05G0286800 Rorug05G0286900 Rorug06G0261200 Rorug07G0200800
rosa_samantha	Rh1AG098700 Rh1BG054000 Rh1BG078400 Rh1BG078500 Rh1BG078600 Rh1BG115300 Rh1CG094700 Rh1CG138500 Rh2BG676800 Rh2BG677200 Rh2CG639900 Rh2CG640000 Rh2CG640100 Rh2CG640400 Rh2CG640500 Rh2DG690700 Rh2DG691000 Rh2DG691100 Rh3AG005200 Rh3BG004800 Rh3BG004900 Rh3DG005100 Rh3DG005300 Rh5AG290500 Rh5AG357000 Rh5AG357100 Rh5AG357300 Rh5BG296700 Rh5BG369300 Rh5CG326700 Rh5CG392000 Rh5DG310400 Rh6BG381100 Rh6DG373800
rosa_wichuraiana	Rw0G010260 Rw1G007710 Rw1G009530 Rw1G011920 Rw2G004130 Rw2G054610 Rw3G000390 Rw5G026850 Rw5G026940 Rw5G033530 Rw5G033720 Rw5G033730 Rw5G033760 Rw6G032520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	202
AclWI	GGATC	1 cut(s)	5
AcuI	CTGAAG	1 cut(s)	76
AjuI	GAANNNNNNNTTGG	2 cut(s)	74, 106
AluBI	AGCT	2 cut(s)	112, 178
AluI	AGCT	2 cut(s)	112, 178
Alw21I	GWGCWC	1 cut(s)	114
AlwI	GGATC	1 cut(s)	5
AoxI	GGCC	1 cut(s)	126
ArsI	GACNNNNNNTTYG	2 cut(s)	127, 159
AspS9I	GGNCC	1 cut(s)	126
AsuC2I	CCSGG	1 cut(s)	147
BanII	GRGCYC	1 cut(s)	114
Bbv12I	GWGCWC	1 cut(s)	114
BccI	CCATC	2 cut(s)	218, 286
BcnI	CCSGG	1 cut(s)	147
BfaI	CTAG	1 cut(s)	245
Bme1390I	CCNGG	1 cut(s)	147
BmgT120I	GGNCC	1 cut(s)	126
BmiI	GGNNCC	2 cut(s)	59, 127
BmrFI	CCNGG	1 cut(s)	147
BmsI	GCATC	1 cut(s)	22
BpuMI	CCSGG	1 cut(s)	147
Bse118I	RCCGGY	1 cut(s)	128
Bse1I	ACTGG	1 cut(s)	222
BseGI	GGATG	1 cut(s)	34
BseMII	CTCAG	1 cut(s)	246
BseNI	ACTGG	1 cut(s)	222
Bsh1285I	CGRYCG	1 cut(s)	133
BshFI	GGCC	1 cut(s)	128
BsiEI	CGRYCG	1 cut(s)	133
BsiHKAI	GWGCWC	1 cut(s)	114
BsiSI	CCGG	2 cut(s)	129, 146
BsnI	GGCC	1 cut(s)	128
Bsp1286I	GDGCHC	1 cut(s)	114
Bsp143I	GATC	1 cut(s)	10
BspACI	CCGC	1 cut(s)	202
BspANI	GGCC	1 cut(s)	128
BspCNI	CTCAG	1 cut(s)	247
BspLI	GGNNCC	2 cut(s)	59, 127
BspPI	GGATC	1 cut(s)	5
BsrFI	RCCGGY	1 cut(s)	128
BsrI	ACTGG	1 cut(s)	222
BssAI	RCCGGY	1 cut(s)	128
BssMI	GATC	1 cut(s)	10
BstDEI	CTNAG	1 cut(s)	255
BstF5I	GGATG	1 cut(s)	34
BstKTI	GATC	1 cut(s)	13
BstMBI	GATC	1 cut(s)	10
BstMCI	CGRYCG	1 cut(s)	133
BstNSI	RCATGY	2 cut(s)	154, 276
BstSCI	CCNGG	1 cut(s)	145
BstX2I	RGATCY	1 cut(s)	10
BstXI	CCANNNNNNTGG	1 cut(s)	21
BstYI	RGATCY	1 cut(s)	10
BsuRI	GGCC	1 cut(s)	128
BtsCI	GGATG	1 cut(s)	34
BtsI	GCAGTG	1 cut(s)	174
BtsIMutI	CAGTG	1 cut(s)	174
Cfr10I	RCCGGY	1 cut(s)	128
Cfr13I	GGNCC	1 cut(s)	126
CviAII	CATG	5 cut(s)	65, 151, 250, 273, 285
CviJI	RGCY	6 cut(s)	49, 112, 128, 178, 221, 289
CviKI_1	RGCY	6 cut(s)	49, 112, 128, 178, 221, 289
DdeI	CTNAG	1 cut(s)	255
DpnI	GATC	1 cut(s)	12
DpnII	GATC	1 cut(s)	10
Ecl136II	GAGCTC	1 cut(s)	112
Eco24I	GRGCYC	1 cut(s)	114
Eco53kI	GAGCTC	1 cut(s)	112
Eco57I	CTGAAG	1 cut(s)	76
EcoICRI	GAGCTC	1 cut(s)	112
EcoT38I	GRGCYC	1 cut(s)	114
FaeI	CATG	5 cut(s)	68, 154, 253, 276, 288
FaiI	YATR	7 cut(s)	66, 74, 142, 152, 251, 274, 286
FatI	CATG	5 cut(s)	64, 150, 249, 272, 284
FokI	GGATG	1 cut(s)	41
FriOI	GRGCYC	1 cut(s)	114
FspBI	CTAG	1 cut(s)	245
HaeIII	GGCC	1 cut(s)	128
HapII	CCGG	2 cut(s)	129, 146
Hin1II	CATG	5 cut(s)	68, 154, 253, 276, 288
HinfI	GANTC	2 cut(s)	38, 68
HpaII	CCGG	2 cut(s)	129, 146
Hpy188I	TCNGA	1 cut(s)	95
Hpy188III	TCNNGA	1 cut(s)	14
HpyCH4V	TGCA	1 cut(s)	167
HpyF3I	CTNAG	1 cut(s)	255
Hsp92II	CATG	5 cut(s)	68, 154, 253, 276, 288
Kzo9I	GATC	1 cut(s)	10
LmnI	GCTCC	1 cut(s)	266
LpnPI	CCDG	6 cut(s)	27, 63, 142, 159, 203, 249
LweI	GCATC	1 cut(s)	22
MaeI	CTAG	1 cut(s)	245
MalI	GATC	1 cut(s)	12
MboI	GATC	1 cut(s)	10
MboII	GAAGA	1 cut(s)	147
MfeI	CAATTG	1 cut(s)	191
MflI	RGATCY	1 cut(s)	10
MhlI	GDGCHC	1 cut(s)	114
MluCI	AATT	1 cut(s)	191
MlyI	GAGTC	1 cut(s)	62
MnlI	CCTC	4 cut(s)	48, 71, 89, 292
MseI	TTAA	1 cut(s)	45
MspI	CCGG	2 cut(s)	129, 146
MspR9I	CCNGG	1 cut(s)	147
MunI	CAATTG	1 cut(s)	191
NciI	CCSGG	1 cut(s)	147
NdeII	GATC	1 cut(s)	10
NlaIII	CATG	5 cut(s)	68, 154, 253, 276, 288
NlaIV	GGNNCC	2 cut(s)	59, 127
NspI	RCATGY	2 cut(s)	154, 276
PfeI	GAWTC	1 cut(s)	38
PleI	GAGTC	1 cut(s)	62
PpsI	GAGTC	1 cut(s)	62
Psp124BI	GAGCTC	1 cut(s)	114
PspN4I	GGNNCC	2 cut(s)	59, 127
PspPI	GGNCC	1 cut(s)	126
PsuI	RGATCY	1 cut(s)	10
SacI	GAGCTC	1 cut(s)	114
SaqAI	TTAA	1 cut(s)	45
Sau3AI	GATC	1 cut(s)	10
Sau96I	GGNCC	1 cut(s)	126
SchI	GAGTC	1 cut(s)	62
ScrFI	CCNGG	1 cut(s)	147
SduI	GDGCHC	1 cut(s)	114
SetI	ASST	3 cut(s)	59, 114, 180
SfaNI	GCATC	1 cut(s)	22
Sse9I	AATT	1 cut(s)	191
SsiI	CCGC	1 cut(s)	202
SspMI	CTAG	1 cut(s)	245
SstI	GAGCTC	1 cut(s)	114
StyD4I	CCNGG	1 cut(s)	145
TaqI	TCGA	2 cut(s)	87, 133
TasI	AATT	1 cut(s)	191
TfiI	GAWTC	1 cut(s)	38
Tru1I	TTAA	1 cut(s)	45
Tru9I	TTAA	1 cut(s)	45
TscAI	CASTG	1 cut(s)	174
TspDTI	ATGAA	1 cut(s)	255
TspRI	CASTG	1 cut(s)	174
XceI	RCATGY	2 cut(s)	154, 276
XspI	CTAG	1 cut(s)	245

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.