Rmu_co8294571.1_g000001

Premnaspirodiene oxygenase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8294571.1
Physical Location & Seq
Forward (+)
1 .. 829
829 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8294571.1_g000001.1.cds

Sequence Viewer

Length: 648 bp
gagatattctcagcagggagtgagactacagctaccaccatagaatgggcaatgtcacaattgatgagaaatccaacagtaatgagtaaggctcaagccgaggttcgacgagtctttcaaggaaagccgaaaattgaagaagcagacgttcaaaaactggaatacttgagagcagtggtaaaagaaacactgagattacaccctccagcaccattattcccaagagaatcaagagaaagatgtgaaatcggaggatacgaagtccaagcgaaaaccaaaatgatcatcaatgaatgggccattggaagagacccggagagttgggttgaagcggagtcgtttaagccagagaggttcctccatggtggttctgattccagcatggacttcaaagcgtctgacttcaagttcactccatttggggctggtagaagatcgtgtccgggtatttcttttggcctttccatggttgaacttgctttttctcatttgctctatcacttcgattgggagctgggaaatgggatcaaaccagatgagcttgatatgactgagacttttgggttcacatgtaggagaaagaatgaattgtacttgattgccaagcctccatcatcgttttccttcgctcagtctgagacatcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

215

Amino Acids

24.39

Weight (kDa)

5.7

Isoelectric Point (pI)

45.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000132)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g03210 FvH4_3g24170 FvH4_3g24171 FvH4_6g02110 FvH4_6g02110 FvH4_6g21500 FvH4_6g44530 FvH4_6g44700 FvH4_6g44700 FvH4_6g44710 FvH4_6g44730 FvH4_6g44750 FvH4_6g44751 FvH4_6g44751 FvH4_6g53570
malus_domestica MD00G1138500.v1.1 MD00G1138600.v1.1 MD00G1138700.v1.1 MD00G1153200.v1.1 MD00G1153300.v1.1 MD00G1153400.v1.1 MD00G1153500.v1.1 MD00G1153600.v1.1 MD00G1153800.v1.1 MD00G1153900.v1.1 MD00G1154000.v1.1 MD03G1187300.v1.1 MD04G1245500.v1.1 MD11G1202200.v1.1 MD11G1202300.v1.1 MD11G1202500.v1.1 MD14G1096600.v1.1 MD14G1096700.v1.1 MD17G1000100.v1.1 MD17G1000200.v1.1 MD17G1000300.v1.1
prunus_persica Prupe.1G492000_v2.0.a1 Prupe.1G492100_v2.0.a1 Prupe.2G073800_v2.0.a1 Prupe.2G073900_v2.0.a1 Prupe.2G074300_v2.0.a1 Prupe.3G306800_v2.0.a1 Prupe.4G237900_v2.0.a1 Prupe.4G238000_v2.0.a1 Prupe.4G238200_v2.0.a1 Prupe.4G238300_v2.0.a1 Prupe.4G238600_v2.0.a1 Prupe.4G239200_v2.0.a1 Prupe.4G239300_v2.0.a1
pyrus_communis pycom03g13950 pycom03g14010 pycom04g21620 pycom04g21630 pycom111g00820 pycom11g17490 pycom11g17500 pycom17g00860 pycom17g00880
rosa_chinensis RchiOBHm_Chr1g0325151 RchiOBHm_Chr1g0329431 RchiOBHm_Chr1g0334551 RchiOBHm_Chr1g0334561 RchiOBHm_Chr1g0336531 RchiOBHm_Chr1g0336541 RchiOBHm_Chr2g0175621 RchiOBHm_Chr2g0175641 RchiOBHm_Chr2g0175651 RchiOBHm_Chr2g0175701 RchiOBHm_Chr2g0175711 RchiOBHm_Chr3g0447771 RchiOBHm_Chr3g0447781 RchiOBHm_Chr3g0447791 RchiOBHm_Chr3g0447801 RchiOBHm_Chr5g0043061 RchiOBHm_Chr5g0043071 RchiOBHm_Chr5g0043221 RchiOBHm_Chr5g0043231 RchiOBHm_Chr5g0043921 RchiOBHm_Chr5g0054481 RchiOBHm_Chr5g0054491 RchiOBHm_Chr5g0054511 RchiOBHm_Chr5g0054551 RchiOBHm_Chr5g0054561 RchiOBHm_Chr5g0054581 RchiOBHm_Chr6g0296341
rosa_laevigata RLG00000011704 RLG00000022344 RLG00000022345 RLG00000022350 RLG00000022351 RLG00000025970 RLG00000025971 RLG00000025972 RLG00000029355 RLG00000029356 RLG00000029886 RLG00000030155 RLG00000034172 RLG00000034938
rosa_multiflora Rmu_co8138254.1_g000001 Rmu_co8268883.1_g000001 Rmu_co8271167.1_g000001 Rmu_co8294571.1_g000001 Rmu_co8350865.1_g000001 Rmu_co8364355.1_g000001 Rmu_co8416839.1_g000001 Rmu_sc0000698.1_g000089 Rmu_sc0000698.1_g000146 Rmu_sc0000998.1_g000014 Rmu_sc0000998.1_g000015 Rmu_sc0000998.1_g000020 Rmu_sc0000998.1_g000021 Rmu_sc0001478.1_g000005 Rmu_sc0001654.1_g000011 Rmu_sc0001981.1_g000002 Rmu_sc0002655.1_g000005 Rmu_sc0002655.1_g000011 Rmu_sc0002655.1_g000018 Rmu_sc0005044.1_g000025 Rmu_sc0005591.1_g000001 Rmu_sc0007742.1_g000012 Rmu_sc0008148.1_g000071 Rmu_sc0009324.1_g000003 Rmu_sc0009324.1_g000004 Rmu_sc0009324.1_g000005 Rmu_sc0014424.1_g000003 Rmu_sc0019317.1_g000001 Rmu_sc0027639.1_g000001
rosa_roxburghii Rroxscaffold_1G00026360 Rroxscaffold_1G00026400 Rroxscaffold_1G00037560 Rroxscaffold_2G00077140 Rroxscaffold_2G00077180 Rroxscaffold_4G00315510 Rroxscaffold_4G00315520 Rroxscaffold_4G00324880 Rroxscaffold_6G00425980 Rroxscaffold_6G00425990 Rroxscaffold_7G00171610 Rroxscaffold_7G00178470 Rroxscaffold_7G00178490
rosa_rugosa Rorug01G0050000 Rorug01G0079800 Rorug01G0126000 Rorug01G0126400 Rorug02G0586700 Rorug02G0586700 Rorug02G0586800 Rorug02G0587000 Rorug02G0605600 Rorug02G0605700 Rorug05G0123000 Rorug05G0204600 Rorug05G0204800 Rorug05G0209100 Rorug05G0286600 Rorug05G0286800 Rorug05G0286900 Rorug06G0261200 Rorug07G0200800
rosa_samantha Rh1AG098700 Rh1BG054000 Rh1BG078400 Rh1BG078500 Rh1BG078600 Rh1BG115300 Rh1CG094700 Rh1CG138500 Rh2BG676800 Rh2BG677200 Rh2CG639900 Rh2CG640000 Rh2CG640100 Rh2CG640400 Rh2CG640500 Rh2DG690700 Rh2DG691000 Rh2DG691100 Rh3AG005200 Rh3BG004800 Rh3BG004900 Rh3DG005100 Rh3DG005300 Rh5AG290500 Rh5AG357000 Rh5AG357100 Rh5AG357300 Rh5BG296700 Rh5BG369300 Rh5CG326700 Rh5CG392000 Rh5DG310400 Rh6BG381100 Rh6DG373800
rosa_wichuraiana Rw0G010260 Rw1G007710 Rw1G009530 Rw1G011920 Rw2G004130 Rw2G054610 Rw3G000390 Rw5G026850 Rw5G026940 Rw5G033530 Rw5G033720 Rw5G033730 Rw5G033760 Rw6G032520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 45
AciI CCGC 1 cut(s) 332
AclWI GGATC 1 cut(s) 533
AfaI GTAC 1 cut(s) 593
AfiI CCNNNNNNNGG 2 cut(s) 45, 466
AflIII ACRYGT 1 cut(s) 569
AgsI TTSAA 7 cut(s) 119, 137, 152, 329, 391, 406, 473
AjuI GAANNNNNNNTTGG 2 cut(s) 285, 317
AluBI AGCT 3 cut(s) 32, 514, 541
AluI AGCT 3 cut(s) 32, 514, 541
Alw26I GTCTC 4 cut(s) 17, 303, 548, 632
AlwI GGATC 1 cut(s) 533
AoxI GGCC 2 cut(s) 297, 457
AspS9I GGNCC 1 cut(s) 297
AsuC2I CCSGG 2 cut(s) 314, 444
BccI CCATC 1 cut(s) 619
BciVI GTATCC 1 cut(s) 248
BclI TGATCA 1 cut(s) 282
BcnI CCSGG 2 cut(s) 314, 444
BcoDI GTCTC 4 cut(s) 17, 303, 548, 632
BfmI CTRYAG 1 cut(s) 27
BfuI GTATCC 1 cut(s) 248
Bme1390I CCNGG 2 cut(s) 314, 444
BmgT120I GGNCC 1 cut(s) 297
BmiI GGNNCC 1 cut(s) 356
BmrFI CCNGG 2 cut(s) 314, 444
BplI GAGNNNNNCTC 3 cut(s) 25, 76, 108
BpmI CTGGAG 1 cut(s) 189
BpuEI CTTGAG 2 cut(s) 78, 187
BpuMI CCSGG 2 cut(s) 314, 444
BsaI GGTCTC 1 cut(s) 303
BsaJI CCNNGG 3 cut(s) 99, 361, 465
Bsc4I CCNNNNNNNGG 2 cut(s) 45, 466
Bse1I ACTGG 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 57
BseDI CCNNGG 3 cut(s) 99, 361, 465
BseGI GGATG 1 cut(s) 641
BseLI CCNNNNNNNGG 2 cut(s) 45, 466
BseMI GCAATG 1 cut(s) 57
BseMII CTCAG 5 cut(s) 24, 182, 543, 627, 644
BseNI ACTGG 1 cut(s) 162
BseYI CCCAGC 1 cut(s) 514
BshFI GGCC 2 cut(s) 299, 459
BsiSI CCGG 2 cut(s) 314, 443
BslI CCNNNNNNNGG 2 cut(s) 45, 466
BsmAI GTCTC 4 cut(s) 17, 303, 548, 632
BsnI GGCC 2 cut(s) 299, 459
Bso31I GGTCTC 1 cut(s) 303
Bsp143I GATC 3 cut(s) 282, 434, 525
Bsp19I CCATGG 2 cut(s) 361, 465
BspACI CCGC 1 cut(s) 332
BspANI GGCC 2 cut(s) 299, 459
BspCNI CTCAG 5 cut(s) 23, 183, 544, 628, 643
BspLI GGNNCC 1 cut(s) 356
BspPI GGATC 1 cut(s) 533
BspTNI GGTCTC 1 cut(s) 303
BsrDI GCAATG 1 cut(s) 57
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 3 cut(s) 99, 361, 465
BssMI GATC 3 cut(s) 282, 434, 525
BssT1I CCWWGG 2 cut(s) 361, 465
Bst4CI ACNGT 1 cut(s) 79
Bst6I CTCTTC 1 cut(s) 301
BstDEI CTNAG 5 cut(s) 10, 191, 552, 630, 636
BstDSI CCRYGG 2 cut(s) 361, 465
BstF5I GGATG 1 cut(s) 641
BstKTI GATC 3 cut(s) 285, 437, 528
BstMAI GTCTC 4 cut(s) 17, 303, 548, 632
BstMBI GATC 3 cut(s) 282, 434, 525
BstNSI RCATGY 1 cut(s) 573
BstSCI CCNGG 2 cut(s) 312, 442
BstSFI CTRYAG 1 cut(s) 27
BsuI GTATCC 1 cut(s) 248
BsuRI GGCC 2 cut(s) 299, 459
BtgI CCRYGG 2 cut(s) 361, 465
BtsCI GGATG 1 cut(s) 641
BtsI GCAGTG 1 cut(s) 180
BtsIMutI CAGTG 2 cut(s) 180, 188
Cfr13I GGNCC 1 cut(s) 297
CseI GACGC 1 cut(s) 384
Csp6I GTAC 1 cut(s) 592
CviAII CATG 4 cut(s) 362, 382, 466, 570
CviQI GTAC 1 cut(s) 592
DdeI CTNAG 5 cut(s) 10, 191, 552, 630, 636
DpnI GATC 3 cut(s) 284, 436, 527
DpnII GATC 3 cut(s) 282, 434, 525
Eam1104I CTCTTC 1 cut(s) 301
EarI CTCTTC 1 cut(s) 301
Eco130I CCWWGG 2 cut(s) 361, 465
Eco31I GGTCTC 1 cut(s) 303
EcoT14I CCWWGG 2 cut(s) 361, 465
ErhI CCWWGG 2 cut(s) 361, 465
FaeI CATG 4 cut(s) 365, 385, 469, 573
FaiI YATR 6 cut(s) 41, 363, 383, 467, 548, 571
FatI CATG 4 cut(s) 361, 381, 465, 569
FbaI TGATCA 1 cut(s) 282
FokI GGATG 1 cut(s) 628
GsaI CCCAGC 1 cut(s) 518
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 2 cut(s) 299, 459
HapII CCGG 2 cut(s) 314, 443
HgaI GACGC 1 cut(s) 384
Hin1II CATG 4 cut(s) 365, 385, 469, 573
HinfI GANTC 4 cut(s) 111, 227, 335, 374
HpaII CCGG 2 cut(s) 314, 443
Hpy166II GTNNAC 2 cut(s) 411, 567
Hpy188I TCNGA 4 cut(s) 251, 373, 400, 637
Hpy188III TCNNGA 2 cut(s) 231, 645
Hpy8I GTNNAC 2 cut(s) 411, 567
Hpy99I CGWCG 1 cut(s) 111
HpyAV CCTTC 1 cut(s) 634
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4IV ACGT 1 cut(s) 147
HpyF3I CTNAG 5 cut(s) 10, 191, 552, 630, 636
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 4 cut(s) 365, 385, 469, 573
Ksp22I TGATCA 1 cut(s) 282
Kzo9I GATC 3 cut(s) 282, 434, 525
LmnI GCTCC 1 cut(s) 511
LpnPI CCDG 9 cut(s) 143, 219, 327, 360, 391, 411, 456, 500, 546
MaeII ACGT 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 54
MalI GATC 3 cut(s) 284, 436, 527
MboI GATC 3 cut(s) 282, 434, 525
MboII GAAGA 3 cut(s) 149, 318, 444
MfeI CAATTG 1 cut(s) 59
MluCI AATT 3 cut(s) 59, 132, 587
MlyI GAGTC 2 cut(s) 120, 344
MmeI TCCRAC 1 cut(s) 98
MnlI CCTC 6 cut(s) 94, 213, 245, 345, 368, 618
MseI TTAA 1 cut(s) 342
MspI CCGG 2 cut(s) 314, 443
MspR9I CCNGG 2 cut(s) 314, 444
MunI CAATTG 1 cut(s) 59
NciI CCSGG 2 cut(s) 314, 444
NcoI CCATGG 2 cut(s) 361, 465
NdeII GATC 3 cut(s) 282, 434, 525
NlaIII CATG 4 cut(s) 365, 385, 469, 573
NlaIV GGNNCC 1 cut(s) 356
NmeAIII GCCGAG 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 54
NspI RCATGY 1 cut(s) 573
PciI ACATGT 1 cut(s) 569
PcsI WCGNNNNNNNCGW 1 cut(s) 255
PfeI GAWTC 2 cut(s) 227, 374
PflMI CCANNNNNTGG 1 cut(s) 45
PleI GAGTC 2 cut(s) 119, 343
PpsI GAGTC 2 cut(s) 119, 343
PscI ACATGT 1 cut(s) 569
PspFI CCCAGC 1 cut(s) 514
PspN4I GGNNCC 1 cut(s) 356
PspPI GGNCC 1 cut(s) 297
RsaI GTAC 1 cut(s) 593
RsaNI GTAC 1 cut(s) 592
SaqAI TTAA 1 cut(s) 342
Sau3AI GATC 3 cut(s) 282, 434, 525
Sau96I GGNCC 1 cut(s) 297
SchI GAGTC 2 cut(s) 120, 344
ScrFI CCNGG 2 cut(s) 314, 444
SetI ASST 6 cut(s) 34, 105, 150, 356, 516, 543
SfcI CTRYAG 1 cut(s) 27
SmlI CTYRAG 2 cut(s) 93, 166
SmoI CTYRAG 2 cut(s) 93, 166
Sse9I AATT 3 cut(s) 59, 132, 587
SsiI CCGC 1 cut(s) 332
StyD4I CCNGG 2 cut(s) 312, 442
StyI CCWWGG 2 cut(s) 361, 465
TaaI ACNGT 1 cut(s) 79
TaiI ACGT 1 cut(s) 150
TaqI TCGA 2 cut(s) 106, 504
TasI AATT 3 cut(s) 59, 132, 587
TatI WGTACW 1 cut(s) 591
TfiI GAWTC 2 cut(s) 227, 374
Tru1I TTAA 1 cut(s) 342
Tru9I TTAA 1 cut(s) 342
TscAI CASTG 2 cut(s) 180, 195
TseFI GTSAC 1 cut(s) 54
Tsp45I GTSAC 1 cut(s) 54
TspDTI ATGAA 2 cut(s) 306, 600
TspRI CASTG 2 cut(s) 180, 195
Van91I CCANNNNNTGG 1 cut(s) 45
XceI RCATGY 1 cut(s) 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.