Rmu_sc0002655.1_g000005

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002655.1
Physical Location & Seq
Forward (+)
12147 .. 12698
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002655.1_g000005.1.cds

Sequence Viewer

Length: 552 bp
atgtcgaaaatggtaaaaacaccacgagtgatggaaaaggtacaagcagaggtgaggcaagtctttggtgctaaaggaaatgtcgatgaaacaggtcttcaggatctgaaattcctaaaggcggtgatcaaagagactttgagattagacctacatactcctctcctacttccaaaagaatgtagtgaaagttgtgagattaatggatatgggataccgatgaaaaccaaagtgattgtgaacgcatgggcgattgggagagatcccaagcattggatcgaagcagaaacatttcatccagagagattcattgatagttgcattgattataggggagctaattttgaatttatactatttggtggaggaaggaggttatgtcctggaatagcatttgctacaccctatgatgcacggaaacgcgaaactgccctcatttcccatatcgaaacgggaaacgggtcggaaacgctaggaaacgtgtatctggatttggaaacgttttggaaacgtatgtattcaatgaggaaacgcctgaatgtaaataaatag
Functional Annotation

Protein Analysis

183

Amino Acids

20.91

Weight (kDa)

9.03

Isoelectric Point (pI)

39.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000132)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g03210 FvH4_3g24170 FvH4_3g24171 FvH4_6g02110 FvH4_6g02110 FvH4_6g21500 FvH4_6g44530 FvH4_6g44700 FvH4_6g44700 FvH4_6g44710 FvH4_6g44730 FvH4_6g44750 FvH4_6g44751 FvH4_6g44751 FvH4_6g53570
malus_domestica MD00G1138500.v1.1 MD00G1138600.v1.1 MD00G1138700.v1.1 MD00G1153200.v1.1 MD00G1153300.v1.1 MD00G1153400.v1.1 MD00G1153500.v1.1 MD00G1153600.v1.1 MD00G1153800.v1.1 MD00G1153900.v1.1 MD00G1154000.v1.1 MD03G1187300.v1.1 MD04G1245500.v1.1 MD11G1202200.v1.1 MD11G1202300.v1.1 MD11G1202500.v1.1 MD14G1096600.v1.1 MD14G1096700.v1.1 MD17G1000100.v1.1 MD17G1000200.v1.1 MD17G1000300.v1.1
prunus_persica Prupe.1G492000_v2.0.a1 Prupe.1G492100_v2.0.a1 Prupe.2G073800_v2.0.a1 Prupe.2G073900_v2.0.a1 Prupe.2G074300_v2.0.a1 Prupe.3G306800_v2.0.a1 Prupe.4G237900_v2.0.a1 Prupe.4G238000_v2.0.a1 Prupe.4G238200_v2.0.a1 Prupe.4G238300_v2.0.a1 Prupe.4G238600_v2.0.a1 Prupe.4G239200_v2.0.a1 Prupe.4G239300_v2.0.a1
pyrus_communis pycom03g13950 pycom03g14010 pycom04g21620 pycom04g21630 pycom111g00820 pycom11g17490 pycom11g17500 pycom17g00860 pycom17g00880
rosa_chinensis RchiOBHm_Chr1g0325151 RchiOBHm_Chr1g0329431 RchiOBHm_Chr1g0334551 RchiOBHm_Chr1g0334561 RchiOBHm_Chr1g0336531 RchiOBHm_Chr1g0336541 RchiOBHm_Chr2g0175621 RchiOBHm_Chr2g0175641 RchiOBHm_Chr2g0175651 RchiOBHm_Chr2g0175701 RchiOBHm_Chr2g0175711 RchiOBHm_Chr3g0447771 RchiOBHm_Chr3g0447781 RchiOBHm_Chr3g0447791 RchiOBHm_Chr3g0447801 RchiOBHm_Chr5g0043061 RchiOBHm_Chr5g0043071 RchiOBHm_Chr5g0043221 RchiOBHm_Chr5g0043231 RchiOBHm_Chr5g0043921 RchiOBHm_Chr5g0054481 RchiOBHm_Chr5g0054491 RchiOBHm_Chr5g0054511 RchiOBHm_Chr5g0054551 RchiOBHm_Chr5g0054561 RchiOBHm_Chr5g0054581 RchiOBHm_Chr6g0296341
rosa_laevigata RLG00000011704 RLG00000022344 RLG00000022345 RLG00000022350 RLG00000022351 RLG00000025970 RLG00000025971 RLG00000025972 RLG00000029355 RLG00000029356 RLG00000029886 RLG00000030155 RLG00000034172 RLG00000034938
rosa_multiflora Rmu_co8138254.1_g000001 Rmu_co8268883.1_g000001 Rmu_co8271167.1_g000001 Rmu_co8294571.1_g000001 Rmu_co8350865.1_g000001 Rmu_co8364355.1_g000001 Rmu_co8416839.1_g000001 Rmu_sc0000698.1_g000089 Rmu_sc0000698.1_g000146 Rmu_sc0000998.1_g000014 Rmu_sc0000998.1_g000015 Rmu_sc0000998.1_g000020 Rmu_sc0000998.1_g000021 Rmu_sc0001478.1_g000005 Rmu_sc0001654.1_g000011 Rmu_sc0001981.1_g000002 Rmu_sc0002655.1_g000005 Rmu_sc0002655.1_g000011 Rmu_sc0002655.1_g000018 Rmu_sc0005044.1_g000025 Rmu_sc0005591.1_g000001 Rmu_sc0007742.1_g000012 Rmu_sc0008148.1_g000071 Rmu_sc0009324.1_g000003 Rmu_sc0009324.1_g000004 Rmu_sc0009324.1_g000005 Rmu_sc0014424.1_g000003 Rmu_sc0019317.1_g000001 Rmu_sc0027639.1_g000001
rosa_roxburghii Rroxscaffold_1G00026360 Rroxscaffold_1G00026400 Rroxscaffold_1G00037560 Rroxscaffold_2G00077140 Rroxscaffold_2G00077180 Rroxscaffold_4G00315510 Rroxscaffold_4G00315520 Rroxscaffold_4G00324880 Rroxscaffold_6G00425980 Rroxscaffold_6G00425990 Rroxscaffold_7G00171610 Rroxscaffold_7G00178470 Rroxscaffold_7G00178490
rosa_rugosa Rorug01G0050000 Rorug01G0079800 Rorug01G0126000 Rorug01G0126400 Rorug02G0586700 Rorug02G0586700 Rorug02G0586800 Rorug02G0587000 Rorug02G0605600 Rorug02G0605700 Rorug05G0123000 Rorug05G0204600 Rorug05G0204800 Rorug05G0209100 Rorug05G0286600 Rorug05G0286800 Rorug05G0286900 Rorug06G0261200 Rorug07G0200800
rosa_samantha Rh1AG098700 Rh1BG054000 Rh1BG078400 Rh1BG078500 Rh1BG078600 Rh1BG115300 Rh1CG094700 Rh1CG138500 Rh2BG676800 Rh2BG677200 Rh2CG639900 Rh2CG640000 Rh2CG640100 Rh2CG640400 Rh2CG640500 Rh2DG690700 Rh2DG691000 Rh2DG691100 Rh3AG005200 Rh3BG004800 Rh3BG004900 Rh3DG005100 Rh3DG005300 Rh5AG290500 Rh5AG357000 Rh5AG357100 Rh5AG357300 Rh5BG296700 Rh5BG369300 Rh5CG326700 Rh5CG392000 Rh5DG310400 Rh6BG381100 Rh6DG373800
rosa_wichuraiana Rw0G010260 Rw1G007710 Rw1G009530 Rw1G011920 Rw2G004130 Rw2G054610 Rw3G000390 Rw5G026850 Rw5G026940 Rw5G033530 Rw5G033720 Rw5G033730 Rw5G033760 Rw6G032520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 273
AccII CGCG 1 cut(s) 423
AciI CCGC 1 cut(s) 122
AclI AACGTT 1 cut(s) 500
AclWI GGATC 3 cut(s) 111, 257, 284
AcsI RAATTY 2 cut(s) 110, 347
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 1 cut(s) 42
AfiI CCNNNNNNNGG 2 cut(s) 121, 273
AflIII ACRYGT 1 cut(s) 480
AgsI TTSAA 2 cut(s) 347, 522
AjnI CCWGG 1 cut(s) 382
AluBI AGCT 1 cut(s) 338
AluI AGCT 1 cut(s) 338
Alw26I GTCTC 1 cut(s) 128
AlwI GGATC 3 cut(s) 111, 257, 284
AlwNI CAGNNNCTG 1 cut(s) 106
ApoI RAATTY 2 cut(s) 110, 347
AseI ATTAAT 1 cut(s) 201
Asp700I GAANNNNTTC 1 cut(s) 291
AsuHPI GGTGA 2 cut(s) 64, 136
BauI CACGAG 1 cut(s) 24
BbsI GAAGAC 1 cut(s) 89
BccI CCATC 1 cut(s) 25
BciT130I CCWGG 1 cut(s) 384
BciVI GTATCC 1 cut(s) 207
BclI TGATCA 1 cut(s) 126
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 473
BfuI GTATCC 1 cut(s) 207
Bme1390I CCNGG 1 cut(s) 384
BmrFI CCNGG 1 cut(s) 384
BmsI GCATC 1 cut(s) 400
BpiI GAAGAC 1 cut(s) 89
BsaXI ACNNNNNCTCC 2 cut(s) 364, 394
Bsc4I CCNNNNNNNGG 2 cut(s) 121, 273
BseBI CCWGG 1 cut(s) 384
BseGI GGATG 1 cut(s) 295
BseLI CCNNNNNNNGG 2 cut(s) 121, 273
BseRI GAGGAG 1 cut(s) 150
Bsh1236I CGCG 1 cut(s) 423
BslI CCNNNNNNNGG 2 cut(s) 121, 273
BsmAI GTCTC 1 cut(s) 128
Bsp143I GATC 4 cut(s) 103, 126, 262, 276
BspACI CCGC 1 cut(s) 122
BspFNI CGCG 1 cut(s) 423
BspPI GGATC 3 cut(s) 111, 257, 284
BssMI GATC 4 cut(s) 103, 126, 262, 276
BssSI CACGAG 1 cut(s) 24
Bst2BI CACGAG 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 384
BstF5I GGATG 1 cut(s) 295
BstFNI CGCG 1 cut(s) 423
BstKTI GATC 4 cut(s) 106, 129, 265, 279
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 4 cut(s) 103, 126, 262, 276
BstNI CCWGG 1 cut(s) 384
BstSCI CCNGG 1 cut(s) 382
BstUI CGCG 1 cut(s) 423
BstV2I GAAGAC 1 cut(s) 89
BstX2I RGATCY 2 cut(s) 103, 262
BstYI RGATCY 2 cut(s) 103, 262
BsuI GTATCC 1 cut(s) 207
BtsCI GGATG 1 cut(s) 295
CaiI CAGNNNCTG 1 cut(s) 106
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 246
CviJI RGCY 1 cut(s) 338
CviKI_1 RGCY 1 cut(s) 338
CviQI GTAC 1 cut(s) 41
DpnI GATC 4 cut(s) 105, 128, 264, 278
DpnII GATC 4 cut(s) 103, 126, 262, 276
Eco57I CTGAAG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 382
FaeI CATG 1 cut(s) 249
FaiI YATR 9 cut(s) 156, 210, 247, 330, 353, 379, 408, 444, 515
FatI CATG 1 cut(s) 245
FbaI TGATCA 1 cut(s) 126
FokI GGATG 1 cut(s) 282
FspBI CTAG 1 cut(s) 473
Hin1II CATG 1 cut(s) 249
HinfI GANTC 1 cut(s) 306
HphI GGTGA 2 cut(s) 64, 136
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 108, 466
Hpy188III TCNNGA 3 cut(s) 101, 299, 488
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 363
HpyCH4IV ACGT 3 cut(s) 480, 500, 511
HpyCH4V TGCA 2 cut(s) 321, 413
HpySE526I ACGT 3 cut(s) 480, 500, 511
Hsp92II CATG 1 cut(s) 249
Ksp22I TGATCA 1 cut(s) 126
Kzo9I GATC 4 cut(s) 103, 126, 262, 276
LmnI GCTCC 1 cut(s) 335
LpnPI CCDG 7 cut(s) 78, 86, 312, 369, 396, 473, 548
LweI GCATC 1 cut(s) 400
MaeI CTAG 1 cut(s) 473
MaeII ACGT 3 cut(s) 480, 500, 511
MalI GATC 4 cut(s) 105, 128, 264, 278
MboI GATC 4 cut(s) 103, 126, 262, 276
MboII GAAGA 1 cut(s) 89
MflI RGATCY 2 cut(s) 103, 262
MluCI AATT 3 cut(s) 110, 340, 347
MmeI TCCRAC 1 cut(s) 444
MnlI CCTC 7 cut(s) 43, 48, 171, 359, 366, 443, 519
MroXI GAANNNNTTC 1 cut(s) 291
MseI TTAA 1 cut(s) 201
MspR9I CCNGG 1 cut(s) 384
MvaI CCWGG 1 cut(s) 384
MvnI CGCG 1 cut(s) 423
NdeII GATC 4 cut(s) 103, 126, 262, 276
NlaIII CATG 1 cut(s) 249
PdmI GAANNNNTTC 1 cut(s) 291
PfeI GAWTC 1 cut(s) 306
PflMI CCANNNNNTGG 1 cut(s) 273
PfoI TCCNGGA 1 cut(s) 382
PshBI ATTAAT 1 cut(s) 201
Psp1406I AACGTT 1 cut(s) 500
Psp6I CCWGG 1 cut(s) 382
PspGI CCWGG 1 cut(s) 382
PstNI CAGNNNCTG 1 cut(s) 106
PsuI RGATCY 2 cut(s) 103, 262
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 4 cut(s) 103, 126, 262, 276
ScrFI CCNGG 1 cut(s) 384
SetI ASST 9 cut(s) 42, 54, 97, 153, 340, 377, 483, 503, 514
SfaNI GCATC 1 cut(s) 400
Sse9I AATT 3 cut(s) 110, 340, 347
SsiI CCGC 1 cut(s) 122
SspMI CTAG 1 cut(s) 473
StyD4I CCNGG 1 cut(s) 382
TaiI ACGT 3 cut(s) 483, 503, 514
TaqI TCGA 4 cut(s) 5, 84, 279, 447
TasI AATT 3 cut(s) 110, 340, 347
TfiI GAWTC 1 cut(s) 306
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TspDTI ATGAA 4 cut(s) 102, 236, 284, 298
TspGWI ACGGA 1 cut(s) 430
Van91I CCANNNNNTGG 1 cut(s) 273
VspI ATTAAT 1 cut(s) 201
XapI RAATTY 2 cut(s) 110, 347
XmnI GAANNNNTTC 1 cut(s) 291
XspI CTAG 1 cut(s) 473
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.