Rmu_sc0000998.1_g000020

Premnaspirodiene oxygenase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000998.1
OG0000132
Physical Location & Seq
Reverse (-)
75839 .. 77201
1363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000998.1_g000020.1.cds

Sequence Viewer

Length: 825 bp
atgcaaaaaaagtttggacagattcttgagagtatcatcaacgatcataagatcaaaagtcaaggcaatgagattgacaaaccagaggaagatcttgttgacgtacttctcaaacttcaggagtccaagaagctcgaattcaacttcacaaccgatcagatcaaagatgtcattatggagatattctcagcagggagtgagactacagctaccaccatagaatgggcaatgtcacaattgatgagaaatccaacagtaatgagtaaggctcaagccgaggttcgacgagtctttcaaggaaagccgaaaattgaagaagcagacgttcaaaaactggaatacttgagagcagtggtaaaagaaacactgagattacaccctccagcaccattattcccaagagaatcaagagaaagatgtgaaatcggaggatacgaagtccaagcgaaaaccaaaatgatcatcaatgaatgggccattggaagagacccggagagttgggttgaagcggagtcgtttaagccagagaggttcctccatggtggttctgattccagcatggacttcaaagcgtctgacttcaagttcactccatttggggctggtagaagatcgtgtccgggtatttcttttggcctttccatggttgaacttgctttttctcatttgctctatcacttcgattgggagctgggaaatgggatcaaaccagatgagcttgatatgactgagacttttgggttcacatgtaggagaaagaatgaattgtacttgattgccaagcctccatcatcgttttccttcgctcagtctgagacatcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00590 ko00591 ko01100 ko04212 ko04726 ko04750 ko04913 map00590 map00591 map01100 map04212 map04726 map04750 map04913
Pfam Domains
Protein Families
p450

Protein Analysis

274

Amino Acids

31.28

Weight (kDa)

5.45

Isoelectric Point (pI)

42.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000132)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g03210 FvH4_3g24170 FvH4_3g24171 FvH4_6g02110 FvH4_6g02110 FvH4_6g21500 FvH4_6g44530 FvH4_6g44700 FvH4_6g44700 FvH4_6g44710 FvH4_6g44730 FvH4_6g44750 FvH4_6g44751 FvH4_6g44751 FvH4_6g53570
malus_domestica MD00G1138500.v1.1 MD00G1138600.v1.1 MD00G1138700.v1.1 MD00G1153200.v1.1 MD00G1153300.v1.1 MD00G1153400.v1.1 MD00G1153500.v1.1 MD00G1153600.v1.1 MD00G1153800.v1.1 MD00G1153900.v1.1 MD00G1154000.v1.1 MD03G1187300.v1.1 MD04G1245500.v1.1 MD11G1202200.v1.1 MD11G1202300.v1.1 MD11G1202500.v1.1 MD14G1096600.v1.1 MD14G1096700.v1.1 MD17G1000100.v1.1 MD17G1000200.v1.1 MD17G1000300.v1.1
prunus_persica Prupe.1G492000_v2.0.a1 Prupe.1G492100_v2.0.a1 Prupe.2G073800_v2.0.a1 Prupe.2G073900_v2.0.a1 Prupe.2G074300_v2.0.a1 Prupe.3G306800_v2.0.a1 Prupe.4G237900_v2.0.a1 Prupe.4G238000_v2.0.a1 Prupe.4G238200_v2.0.a1 Prupe.4G238300_v2.0.a1 Prupe.4G238600_v2.0.a1 Prupe.4G239200_v2.0.a1 Prupe.4G239300_v2.0.a1
pyrus_communis pycom03g13950 pycom03g14010 pycom04g21620 pycom04g21630 pycom111g00820 pycom11g17490 pycom11g17500 pycom17g00860 pycom17g00880
rosa_chinensis RchiOBHm_Chr1g0325151 RchiOBHm_Chr1g0329431 RchiOBHm_Chr1g0334551 RchiOBHm_Chr1g0334561 RchiOBHm_Chr1g0336531 RchiOBHm_Chr1g0336541 RchiOBHm_Chr2g0175621 RchiOBHm_Chr2g0175641 RchiOBHm_Chr2g0175651 RchiOBHm_Chr2g0175701 RchiOBHm_Chr2g0175711 RchiOBHm_Chr3g0447771 RchiOBHm_Chr3g0447781 RchiOBHm_Chr3g0447791 RchiOBHm_Chr3g0447801 RchiOBHm_Chr5g0043061 RchiOBHm_Chr5g0043071 RchiOBHm_Chr5g0043221 RchiOBHm_Chr5g0043231 RchiOBHm_Chr5g0043921 RchiOBHm_Chr5g0054481 RchiOBHm_Chr5g0054491 RchiOBHm_Chr5g0054511 RchiOBHm_Chr5g0054551 RchiOBHm_Chr5g0054561 RchiOBHm_Chr5g0054581 RchiOBHm_Chr6g0296341
rosa_laevigata RLG00000011704 RLG00000022344 RLG00000022345 RLG00000022350 RLG00000022351 RLG00000025970 RLG00000025971 RLG00000025972 RLG00000029355 RLG00000029356 RLG00000029886 RLG00000030155 RLG00000034172 RLG00000034938
rosa_multiflora Rmu_co8138254.1_g000001 Rmu_co8268883.1_g000001 Rmu_co8271167.1_g000001 Rmu_co8294571.1_g000001 Rmu_co8350865.1_g000001 Rmu_co8364355.1_g000001 Rmu_co8416839.1_g000001 Rmu_sc0000698.1_g000089 Rmu_sc0000698.1_g000146 Rmu_sc0000998.1_g000014 Rmu_sc0000998.1_g000015 Rmu_sc0000998.1_g000020 Rmu_sc0000998.1_g000021 Rmu_sc0001478.1_g000005 Rmu_sc0001654.1_g000011 Rmu_sc0001981.1_g000002 Rmu_sc0002655.1_g000005 Rmu_sc0002655.1_g000011 Rmu_sc0002655.1_g000018 Rmu_sc0005044.1_g000025 Rmu_sc0005591.1_g000001 Rmu_sc0007742.1_g000012 Rmu_sc0008148.1_g000071 Rmu_sc0009324.1_g000003 Rmu_sc0009324.1_g000004 Rmu_sc0009324.1_g000005 Rmu_sc0014424.1_g000003 Rmu_sc0019317.1_g000001 Rmu_sc0027639.1_g000001
rosa_roxburghii Rroxscaffold_1G00026360 Rroxscaffold_1G00026400 Rroxscaffold_1G00037560 Rroxscaffold_2G00077140 Rroxscaffold_2G00077180 Rroxscaffold_4G00315510 Rroxscaffold_4G00315520 Rroxscaffold_4G00324880 Rroxscaffold_6G00425980 Rroxscaffold_6G00425990 Rroxscaffold_7G00171610 Rroxscaffold_7G00178470 Rroxscaffold_7G00178490
rosa_rugosa Rorug01G0050000 Rorug01G0079800 Rorug01G0126000 Rorug01G0126400 Rorug02G0586700 Rorug02G0586700 Rorug02G0586800 Rorug02G0587000 Rorug02G0605600 Rorug02G0605700 Rorug05G0123000 Rorug05G0204600 Rorug05G0204800 Rorug05G0209100 Rorug05G0286600 Rorug05G0286800 Rorug05G0286900 Rorug06G0261200 Rorug07G0200800
rosa_samantha Rh1AG098700 Rh1BG054000 Rh1BG078400 Rh1BG078500 Rh1BG078600 Rh1BG115300 Rh1CG094700 Rh1CG138500 Rh2BG676800 Rh2BG677200 Rh2CG639900 Rh2CG640000 Rh2CG640100 Rh2CG640400 Rh2CG640500 Rh2DG690700 Rh2DG691000 Rh2DG691100 Rh3AG005200 Rh3BG004800 Rh3BG004900 Rh3DG005100 Rh3DG005300 Rh5AG290500 Rh5AG357000 Rh5AG357100 Rh5AG357300 Rh5BG296700 Rh5BG369300 Rh5CG326700 Rh5CG392000 Rh5DG310400 Rh6BG381100 Rh6DG373800
rosa_wichuraiana Rw0G010260 Rw1G007710 Rw1G009530 Rw1G011920 Rw2G004130 Rw2G054610 Rw3G000390 Rw5G026850 Rw5G026940 Rw5G033530 Rw5G033720 Rw5G033730 Rw5G033760 Rw6G032520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 222
AciI CCGC 1 cut(s) 509
AclWI GGATC 1 cut(s) 710
AcsI RAATTY 1 cut(s) 137
AcuI CTGAAG 1 cut(s) 101
AfaI GTAC 2 cut(s) 105, 770
AfiI CCNNNNNNNGG 2 cut(s) 222, 643
AflIII ACRYGT 1 cut(s) 746
AgsI TTSAA 8 cut(s) 142, 296, 314, 329, 506, 568, 583, 650
AjuI GAANNNNNNNTTGG 2 cut(s) 462, 494
AluBI AGCT 4 cut(s) 133, 209, 691, 718
AluI AGCT 4 cut(s) 133, 209, 691, 718
Alw26I GTCTC 4 cut(s) 194, 480, 725, 809
AlwI GGATC 1 cut(s) 710
AoxI GGCC 2 cut(s) 474, 634
ApoI RAATTY 1 cut(s) 137
AspS9I GGNCC 1 cut(s) 474
AsuC2I CCSGG 2 cut(s) 491, 621
BccI CCATC 1 cut(s) 796
BciVI GTATCC 1 cut(s) 425
BclI TGATCA 1 cut(s) 459
BcnI CCSGG 2 cut(s) 491, 621
BcoDI GTCTC 4 cut(s) 194, 480, 725, 809
BfmI CTRYAG 1 cut(s) 204
BfuI GTATCC 1 cut(s) 425
BglII AGATCT 1 cut(s) 91
Bme1390I CCNGG 2 cut(s) 491, 621
BmgT120I GGNCC 1 cut(s) 474
BmiI GGNNCC 1 cut(s) 533
BmrFI CCNGG 2 cut(s) 491, 621
BplI GAGNNNNNCTC 4 cut(s) 170, 202, 253, 285
BpmI CTGGAG 1 cut(s) 366
BpuEI CTTGAG 3 cut(s) 47, 255, 364
BpuMI CCSGG 2 cut(s) 491, 621
BsaI GGTCTC 1 cut(s) 480
BsaJI CCNNGG 3 cut(s) 276, 538, 642
Bsc4I CCNNNNNNNGG 2 cut(s) 222, 643
Bse1I ACTGG 1 cut(s) 339
Bse3DI GCAATG 2 cut(s) 73, 234
BseDI CCNNGG 3 cut(s) 276, 538, 642
BseGI GGATG 1 cut(s) 818
BseLI CCNNNNNNNGG 2 cut(s) 222, 643
BseMI GCAATG 2 cut(s) 73, 234
BseMII CTCAG 5 cut(s) 201, 359, 720, 804, 821
BseNI ACTGG 1 cut(s) 339
BseYI CCCAGC 1 cut(s) 691
BshFI GGCC 2 cut(s) 476, 636
BsiSI CCGG 2 cut(s) 491, 620
BslI CCNNNNNNNGG 2 cut(s) 222, 643
BsmAI GTCTC 4 cut(s) 194, 480, 725, 809
BsnI GGCC 2 cut(s) 476, 636
Bso31I GGTCTC 1 cut(s) 480
Bsp143I GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
Bsp19I CCATGG 2 cut(s) 538, 642
BspACI CCGC 1 cut(s) 509
BspANI GGCC 2 cut(s) 476, 636
BspCNI CTCAG 5 cut(s) 200, 360, 721, 805, 820
BspLI GGNNCC 1 cut(s) 533
BspPI GGATC 1 cut(s) 710
BspTNI GGTCTC 1 cut(s) 480
BsrDI GCAATG 2 cut(s) 73, 234
BsrI ACTGG 1 cut(s) 339
BssECI CCNNGG 3 cut(s) 276, 538, 642
BssMI GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
BssT1I CCWWGG 2 cut(s) 538, 642
Bst4CI ACNGT 1 cut(s) 256
Bst6I CTCTTC 1 cut(s) 478
BstDEI CTNAG 5 cut(s) 187, 368, 729, 807, 813
BstDSI CCRYGG 2 cut(s) 538, 642
BstF5I GGATG 1 cut(s) 818
BstKTI GATC 8 cut(s) 46, 54, 94, 157, 162, 462, 614, 705
BstMAI GTCTC 4 cut(s) 194, 480, 725, 809
BstMBI GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
BstNSI RCATGY 1 cut(s) 750
BstSCI CCNGG 2 cut(s) 489, 619
BstSFI CTRYAG 1 cut(s) 204
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
BsuI GTATCC 1 cut(s) 425
BsuRI GGCC 2 cut(s) 476, 636
BtgI CCRYGG 2 cut(s) 538, 642
BtsCI GGATG 1 cut(s) 818
BtsI GCAGTG 1 cut(s) 357
BtsIMutI CAGTG 2 cut(s) 357, 365
Cfr13I GGNCC 1 cut(s) 474
CseI GACGC 1 cut(s) 561
Csp6I GTAC 2 cut(s) 104, 769
CviAII CATG 4 cut(s) 539, 559, 643, 747
CviQI GTAC 2 cut(s) 104, 769
DdeI CTNAG 5 cut(s) 187, 368, 729, 807, 813
DpnI GATC 8 cut(s) 45, 53, 93, 156, 161, 461, 613, 704
DpnII GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
Eam1104I CTCTTC 1 cut(s) 478
EarI CTCTTC 1 cut(s) 478
Eco130I CCWWGG 2 cut(s) 538, 642
Eco31I GGTCTC 1 cut(s) 480
Eco57I CTGAAG 1 cut(s) 101
EcoRI GAATTC 1 cut(s) 137
EcoT14I CCWWGG 2 cut(s) 538, 642
ErhI CCWWGG 2 cut(s) 538, 642
FaeI CATG 4 cut(s) 542, 562, 646, 750
FaiI YATR 8 cut(s) 48, 176, 218, 540, 560, 644, 725, 748
FatI CATG 4 cut(s) 538, 558, 642, 746
FbaI TGATCA 1 cut(s) 459
FokI GGATG 1 cut(s) 805
GsaI CCCAGC 1 cut(s) 695
GsuI CTGGAG 1 cut(s) 366
HaeIII GGCC 2 cut(s) 476, 636
HapII CCGG 2 cut(s) 491, 620
HgaI GACGC 1 cut(s) 561
Hin1II CATG 4 cut(s) 542, 562, 646, 750
HincII GTYRAC 1 cut(s) 100
HindII GTYRAC 1 cut(s) 100
HinfI GANTC 6 cut(s) 22, 122, 288, 404, 512, 551
HpaII CCGG 2 cut(s) 491, 620
Hpy166II GTNNAC 3 cut(s) 100, 588, 744
Hpy188I TCNGA 5 cut(s) 159, 428, 550, 577, 814
Hpy188III TCNNGA 4 cut(s) 26, 119, 408, 822
Hpy8I GTNNAC 3 cut(s) 100, 588, 744
Hpy99I CGWCG 1 cut(s) 288
HpyAV CCTTC 1 cut(s) 811
HpyCH4III ACNGT 1 cut(s) 256
HpyCH4IV ACGT 2 cut(s) 102, 324
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 5 cut(s) 187, 368, 729, 807, 813
HpySE526I ACGT 2 cut(s) 102, 324
Hsp92II CATG 4 cut(s) 542, 562, 646, 750
Ksp22I TGATCA 1 cut(s) 459
Kzo9I GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
LmnI GCTCC 1 cut(s) 688
MaeII ACGT 2 cut(s) 102, 324
MaeIII GTNAC 1 cut(s) 231
MalI GATC 8 cut(s) 45, 53, 93, 156, 161, 461, 613, 704
MboI GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
MboII GAAGA 4 cut(s) 101, 326, 495, 621
MfeI CAATTG 1 cut(s) 236
MflI RGATCY 1 cut(s) 91
MluCI AATT 4 cut(s) 137, 236, 309, 764
MlyI GAGTC 3 cut(s) 131, 297, 521
MmeI TCCRAC 1 cut(s) 275
MnlI CCTC 7 cut(s) 79, 271, 390, 422, 522, 545, 795
MseI TTAA 1 cut(s) 519
MspI CCGG 2 cut(s) 491, 620
MspR9I CCNGG 2 cut(s) 491, 621
MunI CAATTG 1 cut(s) 236
NciI CCSGG 2 cut(s) 491, 621
NcoI CCATGG 2 cut(s) 538, 642
NdeII GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
NlaIII CATG 4 cut(s) 542, 562, 646, 750
NlaIV GGNNCC 1 cut(s) 533
NmeAIII GCCGAG 1 cut(s) 301
NmuCI GTSAC 1 cut(s) 231
NspI RCATGY 1 cut(s) 750
PciI ACATGT 1 cut(s) 746
PcsI WCGNNNNNNNCGW 1 cut(s) 432
PfeI GAWTC 3 cut(s) 22, 404, 551
PflMI CCANNNNNTGG 1 cut(s) 222
PleI GAGTC 3 cut(s) 130, 296, 520
PpsI GAGTC 3 cut(s) 130, 296, 520
PscI ACATGT 1 cut(s) 746
PspFI CCCAGC 1 cut(s) 691
PspN4I GGNNCC 1 cut(s) 533
PspPI GGNCC 1 cut(s) 474
PsuI RGATCY 1 cut(s) 91
RsaI GTAC 2 cut(s) 105, 770
RsaNI GTAC 2 cut(s) 104, 769
SaqAI TTAA 1 cut(s) 519
Sau3AI GATC 8 cut(s) 43, 51, 91, 154, 159, 459, 611, 702
Sau96I GGNCC 1 cut(s) 474
SchI GAGTC 3 cut(s) 131, 297, 521
ScrFI CCNGG 2 cut(s) 491, 621
SetI ASST 8 cut(s) 105, 135, 211, 282, 327, 533, 693, 720
SfcI CTRYAG 1 cut(s) 204
SmlI CTYRAG 3 cut(s) 26, 270, 343
SmoI CTYRAG 3 cut(s) 26, 270, 343
Sse9I AATT 4 cut(s) 137, 236, 309, 764
SsiI CCGC 1 cut(s) 509
StyD4I CCNGG 2 cut(s) 489, 619
StyI CCWWGG 2 cut(s) 538, 642
TaaI ACNGT 1 cut(s) 256
TaiI ACGT 2 cut(s) 105, 327
TaqI TCGA 3 cut(s) 135, 283, 681
TasI AATT 4 cut(s) 137, 236, 309, 764
TatI WGTACW 1 cut(s) 768
TfiI GAWTC 3 cut(s) 22, 404, 551
Tru1I TTAA 1 cut(s) 519
Tru9I TTAA 1 cut(s) 519
TscAI CASTG 2 cut(s) 357, 372
TseFI GTSAC 1 cut(s) 231
Tsp45I GTSAC 1 cut(s) 231
TspDTI ATGAA 2 cut(s) 483, 777
TspRI CASTG 2 cut(s) 357, 372
Van91I CCANNNNNTGG 1 cut(s) 222
XapI RAATTY 1 cut(s) 137
XceI RCATGY 1 cut(s) 750
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.