Rmu_sc0005591.1_g000001

iron ion binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005591.1
OG0000132
Physical Location & Seq
Forward (+)
1 .. 981
981 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005591.1_g000001.1.cds

Sequence Viewer

Length: 510 bp
gagtgtagtgatcagatccagcttgatgtcaaaaccaagcatatcaaagctatcacaatggacatgtatacgtctggaagtgaaacttcagcaactaccacagaatgggcaatggcagaactagtgagaaatccaagagtaatggagaaagcacaagccgagatacgacaacttcttgcaggcaagaagaaaatccatgatgcagacattaaaaaactagactacctgaaattggtcgtaaaggaaactctacggttccaaggttcttccattgattttaaagggaccaacttcgaatttattccatttggggctggtaagagaatgtgtccaggcatatcatttggaactgcatcagttgagattgcacttgctcaactgttgtaccacttcaactggaaactccccaatgggacaaaattagaagagcttgacatgactgaatcaatgggaatgagcgcaaggaagaagaatgacttgaaagttattgccattccttacattctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
p450

Protein Analysis

169

Amino Acids

19.02

Weight (kDa)

8.8

Isoelectric Point (pI)

22.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000132)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g03210 FvH4_3g24170 FvH4_3g24171 FvH4_6g02110 FvH4_6g02110 FvH4_6g21500 FvH4_6g44530 FvH4_6g44700 FvH4_6g44700 FvH4_6g44710 FvH4_6g44730 FvH4_6g44750 FvH4_6g44751 FvH4_6g44751 FvH4_6g53570
malus_domestica MD00G1138500.v1.1 MD00G1138600.v1.1 MD00G1138700.v1.1 MD00G1153200.v1.1 MD00G1153300.v1.1 MD00G1153400.v1.1 MD00G1153500.v1.1 MD00G1153600.v1.1 MD00G1153800.v1.1 MD00G1153900.v1.1 MD00G1154000.v1.1 MD03G1187300.v1.1 MD04G1245500.v1.1 MD11G1202200.v1.1 MD11G1202300.v1.1 MD11G1202500.v1.1 MD14G1096600.v1.1 MD14G1096700.v1.1 MD17G1000100.v1.1 MD17G1000200.v1.1 MD17G1000300.v1.1
prunus_persica Prupe.1G492000_v2.0.a1 Prupe.1G492100_v2.0.a1 Prupe.2G073800_v2.0.a1 Prupe.2G073900_v2.0.a1 Prupe.2G074300_v2.0.a1 Prupe.3G306800_v2.0.a1 Prupe.4G237900_v2.0.a1 Prupe.4G238000_v2.0.a1 Prupe.4G238200_v2.0.a1 Prupe.4G238300_v2.0.a1 Prupe.4G238600_v2.0.a1 Prupe.4G239200_v2.0.a1 Prupe.4G239300_v2.0.a1
pyrus_communis pycom03g13950 pycom03g14010 pycom04g21620 pycom04g21630 pycom111g00820 pycom11g17490 pycom11g17500 pycom17g00860 pycom17g00880
rosa_chinensis RchiOBHm_Chr1g0325151 RchiOBHm_Chr1g0329431 RchiOBHm_Chr1g0334551 RchiOBHm_Chr1g0334561 RchiOBHm_Chr1g0336531 RchiOBHm_Chr1g0336541 RchiOBHm_Chr2g0175621 RchiOBHm_Chr2g0175641 RchiOBHm_Chr2g0175651 RchiOBHm_Chr2g0175701 RchiOBHm_Chr2g0175711 RchiOBHm_Chr3g0447771 RchiOBHm_Chr3g0447781 RchiOBHm_Chr3g0447791 RchiOBHm_Chr3g0447801 RchiOBHm_Chr5g0043061 RchiOBHm_Chr5g0043071 RchiOBHm_Chr5g0043221 RchiOBHm_Chr5g0043231 RchiOBHm_Chr5g0043921 RchiOBHm_Chr5g0054481 RchiOBHm_Chr5g0054491 RchiOBHm_Chr5g0054511 RchiOBHm_Chr5g0054551 RchiOBHm_Chr5g0054561 RchiOBHm_Chr5g0054581 RchiOBHm_Chr6g0296341
rosa_laevigata RLG00000011704 RLG00000022344 RLG00000022345 RLG00000022350 RLG00000022351 RLG00000025970 RLG00000025971 RLG00000025972 RLG00000029355 RLG00000029356 RLG00000029886 RLG00000030155 RLG00000034172 RLG00000034938
rosa_multiflora Rmu_co8138254.1_g000001 Rmu_co8268883.1_g000001 Rmu_co8271167.1_g000001 Rmu_co8294571.1_g000001 Rmu_co8350865.1_g000001 Rmu_co8364355.1_g000001 Rmu_co8416839.1_g000001 Rmu_sc0000698.1_g000089 Rmu_sc0000698.1_g000146 Rmu_sc0000998.1_g000014 Rmu_sc0000998.1_g000015 Rmu_sc0000998.1_g000020 Rmu_sc0000998.1_g000021 Rmu_sc0001478.1_g000005 Rmu_sc0001654.1_g000011 Rmu_sc0001981.1_g000002 Rmu_sc0002655.1_g000005 Rmu_sc0002655.1_g000011 Rmu_sc0002655.1_g000018 Rmu_sc0005044.1_g000025 Rmu_sc0005591.1_g000001 Rmu_sc0007742.1_g000012 Rmu_sc0008148.1_g000071 Rmu_sc0009324.1_g000003 Rmu_sc0009324.1_g000004 Rmu_sc0009324.1_g000005 Rmu_sc0014424.1_g000003 Rmu_sc0019317.1_g000001 Rmu_sc0027639.1_g000001
rosa_roxburghii Rroxscaffold_1G00026360 Rroxscaffold_1G00026400 Rroxscaffold_1G00037560 Rroxscaffold_2G00077140 Rroxscaffold_2G00077180 Rroxscaffold_4G00315510 Rroxscaffold_4G00315520 Rroxscaffold_4G00324880 Rroxscaffold_6G00425980 Rroxscaffold_6G00425990 Rroxscaffold_7G00171610 Rroxscaffold_7G00178470 Rroxscaffold_7G00178490
rosa_rugosa Rorug01G0050000 Rorug01G0079800 Rorug01G0126000 Rorug01G0126400 Rorug02G0586700 Rorug02G0586700 Rorug02G0586800 Rorug02G0587000 Rorug02G0605600 Rorug02G0605700 Rorug05G0123000 Rorug05G0204600 Rorug05G0204800 Rorug05G0209100 Rorug05G0286600 Rorug05G0286800 Rorug05G0286900 Rorug06G0261200 Rorug07G0200800
rosa_samantha Rh1AG098700 Rh1BG054000 Rh1BG078400 Rh1BG078500 Rh1BG078600 Rh1BG115300 Rh1CG094700 Rh1CG138500 Rh2BG676800 Rh2BG677200 Rh2CG639900 Rh2CG640000 Rh2CG640100 Rh2CG640400 Rh2CG640500 Rh2DG690700 Rh2DG691000 Rh2DG691100 Rh3AG005200 Rh3BG004800 Rh3BG004900 Rh3DG005100 Rh3DG005300 Rh5AG290500 Rh5AG357000 Rh5AG357100 Rh5AG357300 Rh5BG296700 Rh5BG369300 Rh5CG326700 Rh5CG392000 Rh5DG310400 Rh6BG381100 Rh6DG373800
rosa_wichuraiana Rw0G010260 Rw1G007710 Rw1G009530 Rw1G011920 Rw2G004130 Rw2G054610 Rw3G000390 Rw5G026850 Rw5G026940 Rw5G033530 Rw5G033720 Rw5G033730 Rw5G033760 Rw6G032520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 105
AccI GTMKAC 1 cut(s) 68
AclWI GGATC 1 cut(s) 10
AcsI RAATTY 1 cut(s) 296
AcuI CTGAAG 1 cut(s) 72
AfaI GTAC 1 cut(s) 386
AfiI CCNNNNNNNGG 2 cut(s) 105, 232
AflIII ACRYGT 1 cut(s) 63
AgsI TTSAA 2 cut(s) 394, 481
AhlI ACTAGT 1 cut(s) 121
AjnI CCWGG 1 cut(s) 331
AluBI AGCT 3 cut(s) 22, 50, 430
AluI AGCT 3 cut(s) 22, 50, 430
AlwI GGATC 1 cut(s) 10
ApoI RAATTY 1 cut(s) 296
Asp700I GAANNNNTTC 1 cut(s) 300
AspLEI GCGC 1 cut(s) 461
AspS9I GGNCC 1 cut(s) 285
AsuII TTCGAA 1 cut(s) 294
AvaII GGWCC 1 cut(s) 285
BaeI ACNNNNGTAYC 2 cut(s) 368, 401
BciT130I CCWGG 1 cut(s) 333
BclI TGATCA 1 cut(s) 10
BcuI ACTAGT 1 cut(s) 121
BfaI CTAG 2 cut(s) 122, 218
Bme1390I CCNGG 1 cut(s) 333
Bme18I GGWCC 1 cut(s) 285
BmgT120I GGNCC 1 cut(s) 285
BmiI GGNNCC 2 cut(s) 257, 286
BmrFI CCNGG 1 cut(s) 333
BmsI GCATC 2 cut(s) 190, 362
Bpu14I TTCGAA 1 cut(s) 294
BsaJI CCNNGG 1 cut(s) 259
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 232
Bse1I ACTGG 1 cut(s) 401
Bse3DI GCAATG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 333
BseDI CCNNGG 1 cut(s) 259
BseLI CCNNNNNNNGG 2 cut(s) 105, 232
BseMI GCAATG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 401
BslFI GGGAC 2 cut(s) 298, 427
BslI CCNNNNNNNGG 2 cut(s) 105, 232
BsmFI GGGAC 2 cut(s) 298, 427
Bsp119I TTCGAA 1 cut(s) 294
Bsp143I GATC 2 cut(s) 10, 15
BspLI GGNNCC 2 cut(s) 257, 286
BspPI GGATC 1 cut(s) 10
BspQI GCTCTTC 1 cut(s) 420
BspT104I TTCGAA 1 cut(s) 294
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 1 cut(s) 401
BssECI CCNNGG 1 cut(s) 259
BssMI GATC 2 cut(s) 10, 15
BssNAI GTATAC 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 259
Bst1107I GTATAC 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 333
Bst4CI ACNGT 2 cut(s) 255, 381
Bst6I CTCTTC 1 cut(s) 420
BstBI TTCGAA 1 cut(s) 294
BstC8I GCNNGC 1 cut(s) 181
BstHHI GCGC 1 cut(s) 461
BstKTI GATC 2 cut(s) 13, 18
BstMBI GATC 2 cut(s) 10, 15
BstNI CCWGG 1 cut(s) 333
BstNSI RCATGY 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 331
BstX2I RGATCY 1 cut(s) 15
BstYI RGATCY 1 cut(s) 15
BstZ17I GTATAC 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 181
CfoI GCGC 1 cut(s) 461
Cfr13I GGNCC 1 cut(s) 285
Csp6I GTAC 1 cut(s) 385
CviAII CATG 3 cut(s) 64, 197, 436
CviJI RGCY 5 cut(s) 22, 50, 158, 314, 430
CviKI_1 RGCY 5 cut(s) 22, 50, 158, 314, 430
CviQI GTAC 1 cut(s) 385
DpnI GATC 2 cut(s) 12, 17
DpnII GATC 2 cut(s) 10, 15
DraI TTTAAA 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 420
EarI CTCTTC 1 cut(s) 420
Eco130I CCWWGG 1 cut(s) 259
Eco47I GGWCC 1 cut(s) 285
Eco57I CTGAAG 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 331
EcoT14I CCWWGG 1 cut(s) 259
ErhI CCWWGG 1 cut(s) 259
FaeI CATG 3 cut(s) 67, 200, 439
FaiI YATR 6 cut(s) 42, 65, 69, 198, 338, 437
FalI AAGNNNNNCTT 4 cut(s) 70, 102, 461, 493
FaqI GGGAC 2 cut(s) 298, 427
FatI CATG 3 cut(s) 63, 196, 435
FbaI TGATCA 1 cut(s) 10
FblI GTMKAC 1 cut(s) 68
FspBI CTAG 2 cut(s) 122, 218
GlaI GCGC 1 cut(s) 460
HhaI GCGC 1 cut(s) 461
Hin1II CATG 3 cut(s) 67, 200, 439
Hin6I GCGC 1 cut(s) 459
HinP1I GCGC 1 cut(s) 459
HinfI GANTC 1 cut(s) 443
Hpy166II GTNNAC 1 cut(s) 69
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 75
Hpy8I GTNNAC 1 cut(s) 69
HpyCH4III ACNGT 2 cut(s) 255, 381
HpyCH4IV ACGT 1 cut(s) 71
HpyCH4V TGCA 4 cut(s) 179, 203, 353, 368
HpySE526I ACGT 1 cut(s) 71
Hsp92II CATG 3 cut(s) 67, 200, 439
HspAI GCGC 1 cut(s) 459
Ksp22I TGATCA 1 cut(s) 10
Kzo9I GATC 2 cut(s) 10, 15
LguI GCTCTTC 1 cut(s) 420
LpnPI CCDG 8 cut(s) 32, 60, 165, 239, 300, 318, 345, 382
LweI GCATC 2 cut(s) 190, 362
MaeI CTAG 2 cut(s) 122, 218
MaeII ACGT 1 cut(s) 71
MalI GATC 2 cut(s) 12, 17
MboI GATC 2 cut(s) 10, 15
MboII GAAGA 5 cut(s) 199, 258, 437, 478, 481
MflI RGATCY 1 cut(s) 15
MluCI AATT 3 cut(s) 230, 296, 419
MroXI GAANNNNTTC 1 cut(s) 300
MseI TTAA 2 cut(s) 210, 279
MspR9I CCNGG 1 cut(s) 333
MvaI CCWGG 1 cut(s) 333
NdeII GATC 2 cut(s) 10, 15
NlaIII CATG 3 cut(s) 67, 200, 439
NlaIV GGNNCC 2 cut(s) 257, 286
NmeAIII GCCGAG 1 cut(s) 184
NspI RCATGY 1 cut(s) 67
NspV TTCGAA 1 cut(s) 294
PciI ACATGT 1 cut(s) 63
PciSI GCTCTTC 1 cut(s) 420
PdmI GAANNNNTTC 1 cut(s) 300
PfeI GAWTC 1 cut(s) 443
PflMI CCANNNNNTGG 1 cut(s) 105
PscI ACATGT 1 cut(s) 63
Psp6I CCWGG 1 cut(s) 331
PspGI CCWGG 1 cut(s) 331
PspN4I GGNNCC 2 cut(s) 257, 286
PspPI GGNCC 1 cut(s) 285
PsuI RGATCY 1 cut(s) 15
RsaI GTAC 1 cut(s) 386
RsaNI GTAC 1 cut(s) 385
SapI GCTCTTC 1 cut(s) 420
SaqAI TTAA 2 cut(s) 210, 279
Sau3AI GATC 2 cut(s) 10, 15
Sau96I GGNCC 1 cut(s) 285
ScrFI CCNGG 1 cut(s) 333
SetI ASST 6 cut(s) 24, 52, 74, 228, 265, 432
SfaNI GCATC 2 cut(s) 190, 362
SfuI TTCGAA 1 cut(s) 294
SinI GGWCC 1 cut(s) 285
SpeI ACTAGT 1 cut(s) 121
Sse9I AATT 3 cut(s) 230, 296, 419
SspMI CTAG 2 cut(s) 122, 218
StyD4I CCNGG 1 cut(s) 331
StyI CCWWGG 1 cut(s) 259
TaaI ACNGT 2 cut(s) 255, 381
TaiI ACGT 1 cut(s) 74
TaqI TCGA 1 cut(s) 294
TasI AATT 3 cut(s) 230, 296, 419
TfiI GAWTC 1 cut(s) 443
Tru1I TTAA 2 cut(s) 210, 279
Tru9I TTAA 2 cut(s) 210, 279
Van91I CCANNNNNTGG 1 cut(s) 105
VpaK11BI GGWCC 1 cut(s) 285
XapI RAATTY 1 cut(s) 296
XceI RCATGY 1 cut(s) 67
XmiI GTMKAC 1 cut(s) 68
XmnI GAANNNNTTC 1 cut(s) 300
XspI CTAG 2 cut(s) 122, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.