Rmu_sc0003170.1_g000001

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003170.1
OG0000155
Physical Location & Seq
Forward (+)
1 .. 1826
1826 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003170.1_g000001.1.cds

Sequence Viewer

Length: 460 bp
tgagattagtaatttgggcattcatatttacagcttggatgatgacctagtcccggcaatggtctctcttctcagaggaatgactaatttgaatactctctggataacatctgccaatttgccagccaatatgctctactccaaggttgatgtatctgggtttaatatgggtttttggaaatcccaaaggcttgctttcgtttctcaacttaaggaggtaagaatagagcttgcaaatgggagtaatgagatcgagttagcaaggagagcaccaacctcgtcacagggttcttctcttgccttttgggaaaggacttttgccttacggggcgttacccttgcttcgctgggtgtatcggtggcagtagtaccggcagtcggctcacgaggagactgggactggaagtacggtcgccgggttgatctggtgaggctgacagtcggctcgcgaggagactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD

Protein Analysis

152

Amino Acids

16.7

Weight (kDa)

9.23

Isoelectric Point (pI)

41.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000155)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g20530 FvH4_5g20530 FvH4_5g20611 FvH4_5g20621 FvH4_5g26390 FvH4_5g26400 FvH4_5g26410 FvH4_5g29160 FvH4_5g29160 FvH4_5g29160 FvH4_5g29160 FvH4_6g18920 FvH4_6g18920 FvH4_6g18920 FvH4_6g33960
malus_domestica MD04G1058800.v1.1 MD12G1025400.v1.1 MD14G1024100.v1.1 MD14G1026000.v1.1 MD14G1026300.v1.1 MD14G1026400.v1.1 MD14G1026600.v1.1
prunus_persica Prupe.7G107300_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108700_v2.0.a1
pyrus_communis pycom04g05270 pycom12g02490 pycom12g02500 pycom14g02340 pycom14g02540
rosa_chinensis RchiOBHm_Chr3g0473911 RchiOBHm_Chr3g0473951 RchiOBHm_Chr3g0473961 RchiOBHm_Chr3g0474091 RchiOBHm_Chr3g0474151 RchiOBHm_Chr3g0474171 RchiOBHm_Chr3g0475381 RchiOBHm_Chr3g0475391 RchiOBHm_Chr7g0193261 RchiOBHm_Chr7g0205891 RchiOBHm_Chr7g0205901 RchiOBHm_Chr7g0205931 RchiOBHm_Chr7g0205941 RchiOBHm_Chr7g0205961 RchiOBHm_Chr7g0217271 RchiOBHm_Chr7g0217281
rosa_laevigata RLG00000002499 RLG00000003343 RLG00000003344 RLG00000003345 RLG00000003348 RLG00000004282 RLG00000023847 RLG00000023943 RLG00000023945 RLG00000023951 RLG00000023964 RLG00000023965 RLG00000023969 RLG00000023971
rosa_multiflora Rmu_co8482831.1_g000001 Rmu_sc0000076.1_g000028 Rmu_sc0000076.1_g000030 Rmu_sc0000076.1_g000032 Rmu_sc0000076.1_g000033 Rmu_sc0002414.1_g000019 Rmu_sc0002414.1_g000037 Rmu_sc0003170.1_g000001 Rmu_sc0003170.1_g000026 Rmu_sc0004084.1_g000005 Rmu_sc0004084.1_g000006 Rmu_sc0004084.1_g000014 Rmu_sc0004507.1_g000027 Rmu_sc0005137.1_g000001 Rmu_sc0005137.1_g000022 Rmu_sc0005137.1_g000038 Rmu_sc0007659.1_g000002 Rmu_sc0010415.1_g000002 Rmu_sc0013923.1_g000002 Rmu_sc0015051.1_g000001 Rmu_sc0016637.1_g000001 Rmu_sc0016637.1_g000003 Rmu_sc0018174.1_g000001 Rmu_sc0033900.1_g000001
rosa_roxburghii Rroxscaffold_3G00242480 Rroxscaffold_3G00251850 Rroxscaffold_3G00251880 Rroxscaffold_3G00251890 Rroxscaffold_3G00262240 Rroxscaffold_6G00406350 Rroxscaffold_6G00407490 Rroxscaffold_6G00407590 Rroxscaffold_6G00407650
rosa_rugosa Rorug03G0136900 Rorug03G0136900 Rorug03G0136900 Rorug03G0137000 Rorug03G0137200 Rorug03G0137400 Rorug03G0138400 Rorug03G0138700 Rorug03G0138700 Rorug03G0139000 Rorug03G0139100 Rorug03G0148300 Rorug03G0148400 Rorug03G0148500 Rorug07G0008600 Rorug07G0093700 Rorug07G0093800 Rorug07G0093900 Rorug07G0094000 Rorug07G0167300
rosa_samantha Rh3AG187100 Rh3AG187500 Rh3AG188600 Rh3AG189500 Rh3AG198400 Rh3AG198500 Rh3AG198600 Rh3BG215700 Rh3BG215800 Rh3BG216000 Rh3BG218100 Rh3BG218700 Rh3BG228400 Rh3BG228500 Rh3BG228600 Rh3CG212400 Rh3CG212600 Rh3CG213800 Rh3CG214300 Rh3CG222900 Rh3DG211600 Rh3DG211900 Rh3DG212100 Rh3DG213900 Rh3DG214100 Rh3DG223700 Rh3DG223900 Rh7AG134200 Rh7AG225400 Rh7AG225500 Rh7AG225600 Rh7AG225700 Rh7AG306800 Rh7BG135200 Rh7BG221300 Rh7BG221400 Rh7BG221500 Rh7BG221700 Rh7BG221900 Rh7BG222300 Rh7BG225100 Rh7BG225200 Rh7BG297700 Rh7CG138200 Rh7CG239000 Rh7CG239200 Rh7CG239500 Rh7CG239800 Rh7CG240100 Rh7CG325900 Rh7DG232100 Rh7DG232300 Rh7DG306500
rosa_wichuraiana Rw0G012880 Rw0G012890 Rw3G017130 Rw3G017180 Rw3G017300 Rw3G017310 Rw3G018020 Rw7G011480 Rw7G019440 Rw7G019450 Rw7G019470 Rw7G026050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 449
AfaI GTAC 2 cut(s) 370, 408
AfiI CCNNNNNNNGG 3 cut(s) 53, 59, 378
AflII CTTAAG 1 cut(s) 210
AgsI TTSAA 1 cut(s) 92
AluBI AGCT 2 cut(s) 34, 230
AluI AGCT 2 cut(s) 34, 230
Alw21I GWGCWC 1 cut(s) 272
Alw26I GTCTC 3 cut(s) 68, 385, 448
AsuC2I CCSGG 2 cut(s) 54, 417
AsuHPI GGTGA 1 cut(s) 440
BauI CACGAG 1 cut(s) 385
Bbv12I GWGCWC 1 cut(s) 272
BcgI CGANNNNNNTGC 2 cut(s) 259, 293
BcnI CCSGG 2 cut(s) 54, 417
BcoDI GTCTC 3 cut(s) 68, 385, 448
BfaI CTAG 2 cut(s) 48, 458
BfrI CTTAAG 1 cut(s) 210
Bme1390I CCNGG 2 cut(s) 54, 417
BmrFI CCNGG 2 cut(s) 54, 417
BmrI ACTGGG 1 cut(s) 404
BmuI ACTGGG 1 cut(s) 404
BpuMI CCSGG 2 cut(s) 54, 417
BsaI GGTCTC 1 cut(s) 68
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 3 cut(s) 53, 59, 378
Bse118I RCCGGY 1 cut(s) 371
Bse1I ACTGG 2 cut(s) 399, 405
Bse3DI GCAATG 1 cut(s) 64
BseDI CCNNGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 44
BseLI CCNNNNNNNGG 3 cut(s) 53, 59, 378
BseMI GCAATG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 2 cut(s) 399, 405
BseRI GAGGAG 1 cut(s) 403
BseYI CCCAGC 1 cut(s) 347
Bsh1236I CGCG 1 cut(s) 449
Bsh1285I CGRYCG 1 cut(s) 413
BsiEI CGRYCG 1 cut(s) 413
BsiHKAI GWGCWC 1 cut(s) 272
BsiSI CCGG 3 cut(s) 54, 372, 416
BslFI GGGAC 2 cut(s) 36, 411
BslI CCNNNNNNNGG 3 cut(s) 53, 59, 378
BsmAI GTCTC 3 cut(s) 68, 385, 448
BsmFI GGGAC 2 cut(s) 36, 411
BsmI GAATGC 1 cut(s) 19
Bso31I GGTCTC 1 cut(s) 68
Bsp1286I GDGCHC 1 cut(s) 272
Bsp143I GATC 2 cut(s) 250, 422
Bsp68I TCGCGA 1 cut(s) 449
BspCNI CTCAG 1 cut(s) 85
BspFNI CGCG 1 cut(s) 449
BspTI CTTAAG 1 cut(s) 210
BspTNI GGTCTC 1 cut(s) 68
BsrDI GCAATG 1 cut(s) 64
BsrFI RCCGGY 1 cut(s) 371
BsrI ACTGG 2 cut(s) 399, 405
BssAI RCCGGY 1 cut(s) 371
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 2 cut(s) 250, 422
BssSI CACGAG 1 cut(s) 385
BssT1I CCWWGG 1 cut(s) 142
Bst2BI CACGAG 1 cut(s) 385
Bst4CI ACNGT 2 cut(s) 411, 440
Bst6I CTCTTC 1 cut(s) 73
BstAFI CTTAAG 1 cut(s) 210
BstC8I GCNNGC 4 cut(s) 124, 193, 232, 447
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 44
BstFNI CGCG 1 cut(s) 449
BstKTI GATC 2 cut(s) 253, 425
BstMAI GTCTC 3 cut(s) 68, 385, 448
BstMBI GATC 2 cut(s) 250, 422
BstMCI CGRYCG 1 cut(s) 413
BstMWI GCNNNNNNNGC 1 cut(s) 267
BstSCI CCNGG 2 cut(s) 52, 415
BstUI CGCG 1 cut(s) 449
BtsCI GGATG 1 cut(s) 44
BtuMI TCGCGA 1 cut(s) 449
Cac8I GCNNGC 4 cut(s) 124, 193, 232, 447
Cfr10I RCCGGY 1 cut(s) 371
Csp6I GTAC 2 cut(s) 369, 407
CviJI RGCY 7 cut(s) 34, 126, 191, 230, 382, 434, 445
CviKI_1 RGCY 7 cut(s) 34, 126, 191, 230, 382, 434, 445
CviQI GTAC 2 cut(s) 369, 407
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 252, 424
DpnII GATC 2 cut(s) 250, 422
Eam1104I CTCTTC 1 cut(s) 73
EarI CTCTTC 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 142
Eco31I GGTCTC 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 142
ErhI CCWWGG 1 cut(s) 142
FaiI YATR 3 cut(s) 25, 132, 168
FalI AAGNNNNNCTT 2 cut(s) 179, 211
FaqI GGGAC 2 cut(s) 36, 411
FokI GGATG 1 cut(s) 51
FspBI CTAG 2 cut(s) 48, 458
GsaI CCCAGC 1 cut(s) 351
HapII CCGG 3 cut(s) 54, 372, 416
HpaII CCGG 3 cut(s) 54, 372, 416
HphI GGTGA 1 cut(s) 440
Hpy188I TCNGA 1 cut(s) 75
Hpy188III TCNNGA 3 cut(s) 101, 385, 448
HpyCH4III ACNGT 2 cut(s) 411, 440
HpyCH4V TGCA 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 267
HpyF3I CTNAG 1 cut(s) 72
Kzo9I GATC 2 cut(s) 250, 422
MaeI CTAG 2 cut(s) 48, 458
MaeIII GTNAC 2 cut(s) 280, 332
MalI GATC 2 cut(s) 252, 424
MboI GATC 2 cut(s) 250, 422
MboII GAAGA 2 cut(s) 60, 283
MhlI GDGCHC 1 cut(s) 272
MluCI AATT 3 cut(s) 11, 86, 116
MnlI CCTC 6 cut(s) 69, 209, 287, 381, 424, 444
MseI TTAA 2 cut(s) 163, 211
MspCI CTTAAG 1 cut(s) 210
MspI CCGG 3 cut(s) 54, 372, 416
MspR9I CCNGG 2 cut(s) 54, 417
Mva1269I GAATGC 1 cut(s) 19
MvnI CGCG 1 cut(s) 449
MwoI GCNNNNNNNGC 1 cut(s) 267
NciI CCSGG 2 cut(s) 54, 417
NdeII GATC 2 cut(s) 250, 422
NmuCI GTSAC 1 cut(s) 280
NruI TCGCGA 1 cut(s) 449
PctI GAATGC 1 cut(s) 19
PflFI GACNNNGTC 1 cut(s) 48
PspFI CCCAGC 1 cut(s) 347
PsyI GACNNNGTC 1 cut(s) 48
RruI TCGCGA 1 cut(s) 449
RsaI GTAC 2 cut(s) 370, 408
RsaNI GTAC 2 cut(s) 369, 407
SaqAI TTAA 2 cut(s) 163, 211
Sau3AI GATC 2 cut(s) 250, 422
ScrFI CCNGG 2 cut(s) 54, 417
SduI GDGCHC 1 cut(s) 272
SetI ASST 6 cut(s) 36, 49, 148, 220, 232, 279
SmlI CTYRAG 1 cut(s) 210
SmoI CTYRAG 1 cut(s) 210
Sse9I AATT 3 cut(s) 11, 86, 116
SspMI CTAG 2 cut(s) 48, 458
StyD4I CCNGG 2 cut(s) 52, 415
StyI CCWWGG 1 cut(s) 142
TaaI ACNGT 2 cut(s) 411, 440
TaqI TCGA 1 cut(s) 253
TasI AATT 3 cut(s) 11, 86, 116
Tru1I TTAA 2 cut(s) 163, 211
Tru9I TTAA 2 cut(s) 163, 211
TseFI GTSAC 1 cut(s) 280
Tsp45I GTSAC 1 cut(s) 280
TspDTI ATGAA 1 cut(s) 12
Tth111I GACNNNGTC 1 cut(s) 48
Vha464I CTTAAG 1 cut(s) 210
XspI CTAG 2 cut(s) 48, 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.