Rorug07G0093800

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
7344021 .. 7345225
1205 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0093800.1

Sequence Viewer

Length: 171 bp
ATGGGCTTTTACGTTCTAGGGGTTTGTTTTATATTTGGCTTTGGAATTCCAGTTATTGATCGGAAAGGTTGCAAGAAATGCAGTTTTAATGAGGGAAATCTGATGATCATCCCGGTTAATGATCAAATATCAATAACTGGTGTTAAGCAAAATTTTTATCTTGCTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.22

Weight (kDa)

8.57

Isoelectric Point (pI)

20.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000155)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g20530 FvH4_5g20530 FvH4_5g20611 FvH4_5g20621 FvH4_5g26390 FvH4_5g26400 FvH4_5g26410 FvH4_5g29160 FvH4_5g29160 FvH4_5g29160 FvH4_5g29160 FvH4_6g18920 FvH4_6g18920 FvH4_6g18920 FvH4_6g33960
malus_domestica MD04G1058800.v1.1 MD12G1025400.v1.1 MD14G1024100.v1.1 MD14G1026000.v1.1 MD14G1026300.v1.1 MD14G1026400.v1.1 MD14G1026600.v1.1
prunus_persica Prupe.7G107300_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108600_v2.0.a1 Prupe.7G108700_v2.0.a1
pyrus_communis pycom04g05270 pycom12g02490 pycom12g02500 pycom14g02340 pycom14g02540
rosa_chinensis RchiOBHm_Chr3g0473911 RchiOBHm_Chr3g0473951 RchiOBHm_Chr3g0473961 RchiOBHm_Chr3g0474091 RchiOBHm_Chr3g0474151 RchiOBHm_Chr3g0474171 RchiOBHm_Chr3g0475381 RchiOBHm_Chr3g0475391 RchiOBHm_Chr7g0193261 RchiOBHm_Chr7g0205891 RchiOBHm_Chr7g0205901 RchiOBHm_Chr7g0205931 RchiOBHm_Chr7g0205941 RchiOBHm_Chr7g0205961 RchiOBHm_Chr7g0217271 RchiOBHm_Chr7g0217281
rosa_laevigata RLG00000002499 RLG00000003343 RLG00000003344 RLG00000003345 RLG00000003348 RLG00000004282 RLG00000023847 RLG00000023943 RLG00000023945 RLG00000023951 RLG00000023964 RLG00000023965 RLG00000023969 RLG00000023971
rosa_multiflora Rmu_co8482831.1_g000001 Rmu_sc0000076.1_g000028 Rmu_sc0000076.1_g000030 Rmu_sc0000076.1_g000032 Rmu_sc0000076.1_g000033 Rmu_sc0002414.1_g000019 Rmu_sc0002414.1_g000037 Rmu_sc0003170.1_g000001 Rmu_sc0003170.1_g000026 Rmu_sc0004084.1_g000005 Rmu_sc0004084.1_g000006 Rmu_sc0004084.1_g000014 Rmu_sc0004507.1_g000027 Rmu_sc0005137.1_g000001 Rmu_sc0005137.1_g000022 Rmu_sc0005137.1_g000038 Rmu_sc0007659.1_g000002 Rmu_sc0010415.1_g000002 Rmu_sc0013923.1_g000002 Rmu_sc0015051.1_g000001 Rmu_sc0016637.1_g000001 Rmu_sc0016637.1_g000003 Rmu_sc0018174.1_g000001 Rmu_sc0033900.1_g000001
rosa_roxburghii Rroxscaffold_3G00242480 Rroxscaffold_3G00251850 Rroxscaffold_3G00251880 Rroxscaffold_3G00251890 Rroxscaffold_3G00262240 Rroxscaffold_6G00406350 Rroxscaffold_6G00407490 Rroxscaffold_6G00407590 Rroxscaffold_6G00407650
rosa_rugosa Rorug03G0136900 Rorug03G0136900 Rorug03G0136900 Rorug03G0137000 Rorug03G0137200 Rorug03G0137400 Rorug03G0138400 Rorug03G0138700 Rorug03G0138700 Rorug03G0139000 Rorug03G0139100 Rorug03G0148300 Rorug03G0148400 Rorug03G0148500 Rorug07G0008600 Rorug07G0093700 Rorug07G0093800 Rorug07G0093900 Rorug07G0094000 Rorug07G0167300
rosa_samantha Rh3AG187100 Rh3AG187500 Rh3AG188600 Rh3AG189500 Rh3AG198400 Rh3AG198500 Rh3AG198600 Rh3BG215700 Rh3BG215800 Rh3BG216000 Rh3BG218100 Rh3BG218700 Rh3BG228400 Rh3BG228500 Rh3BG228600 Rh3CG212400 Rh3CG212600 Rh3CG213800 Rh3CG214300 Rh3CG222900 Rh3DG211600 Rh3DG211900 Rh3DG212100 Rh3DG213900 Rh3DG214100 Rh3DG223700 Rh3DG223900 Rh7AG134200 Rh7AG225400 Rh7AG225500 Rh7AG225600 Rh7AG225700 Rh7AG306800 Rh7BG135200 Rh7BG221300 Rh7BG221400 Rh7BG221500 Rh7BG221700 Rh7BG221900 Rh7BG222300 Rh7BG225100 Rh7BG225200 Rh7BG297700 Rh7CG138200 Rh7CG239000 Rh7CG239200 Rh7CG239500 Rh7CG239800 Rh7CG240100 Rh7CG325900 Rh7DG232100 Rh7DG232300 Rh7DG306500
rosa_wichuraiana Rw0G012880 Rw0G012890 Rw3G017130 Rw3G017180 Rw3G017300 Rw3G017310 Rw3G018020 Rw7G011480 Rw7G019440 Rw7G019450 Rw7G019470 Rw7G026050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 169
AcsI RAATTY 2 cut(s) 45, 151
ApoI RAATTY 2 cut(s) 45, 151
AsuC2I CCSGG 1 cut(s) 113
BclI TGATCA 2 cut(s) 105, 121
BcnI CCSGG 1 cut(s) 113
BfaI CTAG 1 cut(s) 17
Bme1390I CCNGG 1 cut(s) 113
BmrFI CCNGG 1 cut(s) 113
BpuMI CCSGG 1 cut(s) 113
BsaBI GATNNNNATC 1 cut(s) 107
Bse1I ACTGG 2 cut(s) 50, 142
Bse8I GATNNNNATC 1 cut(s) 107
BseGI GGATG 1 cut(s) 108
BseJI GATNNNNATC 1 cut(s) 107
BseNI ACTGG 2 cut(s) 50, 142
BsiSI CCGG 1 cut(s) 113
Bsp143I GATC 3 cut(s) 58, 105, 121
BsrI ACTGG 2 cut(s) 50, 142
BssMI GATC 3 cut(s) 58, 105, 121
BstAPI GCANNNNNTGC 1 cut(s) 78
BstF5I GGATG 1 cut(s) 108
BstKTI GATC 3 cut(s) 61, 108, 124
BstMBI GATC 3 cut(s) 58, 105, 121
BstMWI GCNNNNNNNGC 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 111
BtsCI GGATG 1 cut(s) 108
CviJI RGCY 2 cut(s) 6, 39
CviKI_1 RGCY 2 cut(s) 6, 39
DpnI GATC 3 cut(s) 60, 107, 123
DpnII GATC 3 cut(s) 58, 105, 121
EcoRI GAATTC 1 cut(s) 45
FaiI YATR 2 cut(s) 32, 169
FbaI TGATCA 2 cut(s) 105, 121
FokI GGATG 1 cut(s) 95
FspBI CTAG 1 cut(s) 17
HapII CCGG 1 cut(s) 113
HpaII CCGG 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 63, 102
HpyCH4IV ACGT 1 cut(s) 12
HpyCH4V TGCA 2 cut(s) 72, 81
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 12
Ksp22I TGATCA 2 cut(s) 105, 121
Kzo9I GATC 3 cut(s) 58, 105, 121
LpnPI CCDG 3 cut(s) 63, 123, 126
MaeI CTAG 1 cut(s) 17
MaeII ACGT 1 cut(s) 12
MalI GATC 3 cut(s) 60, 107, 123
MboI GATC 3 cut(s) 58, 105, 121
MluCI AATT 2 cut(s) 45, 151
MnlI CCTC 1 cut(s) 85
MseI TTAA 3 cut(s) 87, 117, 144
MspI CCGG 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 78
NciI CCSGG 1 cut(s) 113
NdeII GATC 3 cut(s) 58, 105, 121
PsiI TTATAA 1 cut(s) 169
SaqAI TTAA 3 cut(s) 87, 117, 144
Sau3AI GATC 3 cut(s) 58, 105, 121
ScrFI CCNGG 1 cut(s) 113
SetI ASST 2 cut(s) 15, 70
SgeI CNNG 6 cut(s) 29, 62, 85, 124, 125, 150
Sse9I AATT 2 cut(s) 45, 151
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 111
TaiI ACGT 1 cut(s) 15
TasI AATT 2 cut(s) 45, 151
Tru1I TTAA 3 cut(s) 87, 117, 144
Tru9I TTAA 3 cut(s) 87, 117, 144
XapI RAATTY 2 cut(s) 45, 151
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.