Rroxscaffold_1G00036090

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000483
Physical Location & Seq
Reverse (-)
52736444 .. 52748493
12050 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00036090.1

Sequence Viewer

Length: 519 bp
ATGAGTTTATCAGCTTGTTCTAGATTACTGGGTGGAATTCAAATTCAAGTAGCTGGCTCTGCTCCTGTTCTTGATGATCAGAGCATCATCTTTGGAAGAGACATCCACTTCATTTACACCGGTGAACTGATATCATACTTGAAGGAGAAGAATGATAAACTTTATGTTCTCTTCATCAACGACATGCAGTTGAAAACAAGTCAACAGTACTTCGTATGGAGGTGGGGCAATCGTCGCCGTGTGGCTGTCTTCAATACCTGTTGGTGCCGTCTATTCACTGCCACTTTGAATCCTCGAGGGCTTTACTACGACAAGGATCTCAAGAACCCAACTCCGGAGCGATTCAAGAGATCTGTCTCCAATCGAAACGGTATGGGCAGATCGAGGACAAGAACGTCTTCTTTTGGTTCCGAGAACCTCAAATCTCGGGAGAGGCGGATGAAAGCAATTCGGAACAGCAGAAAAGAACTAGCTACAGACATTGATGCGTTAAAGAGGAAGATTGCTGGAACCGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

172

Amino Acids

19.94

Weight (kDa)

10.28

Isoelectric Point (pI)

46.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000483)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002132.1_g000009 Rmu_sc0002786.1_g000030
rosa_roxburghii Rroxscaffold_159G00432910 Rroxscaffold_159G00433130 Rroxscaffold_166G00440820 Rroxscaffold_173G00435050 Rroxscaffold_174G00435100 Rroxscaffold_180G00433390 Rroxscaffold_180G00433400 Rroxscaffold_180G00433440 Rroxscaffold_180G00433490 Rroxscaffold_1G00000420 Rroxscaffold_1G00000930 Rroxscaffold_1G00002350 Rroxscaffold_1G00003270 Rroxscaffold_1G00003640 Rroxscaffold_1G00004210 Rroxscaffold_1G00022320 Rroxscaffold_1G00036090 Rroxscaffold_1G00042540 Rroxscaffold_2G00080860 Rroxscaffold_2G00084440 Rroxscaffold_2G00085920 Rroxscaffold_2G00087210 Rroxscaffold_2G00087260 Rroxscaffold_2G00089240 Rroxscaffold_2G00096210 Rroxscaffold_2G00098680 Rroxscaffold_2G00099730 Rroxscaffold_2G00102340 Rroxscaffold_2G00102390 Rroxscaffold_2G00107430 Rroxscaffold_2G00115560 Rroxscaffold_2G00128260 Rroxscaffold_3G00221780 Rroxscaffold_3G00224580 Rroxscaffold_3G00225490 Rroxscaffold_3G00234530 Rroxscaffold_3G00235740 Rroxscaffold_3G00236590 Rroxscaffold_3G00239210 Rroxscaffold_3G00239230 Rroxscaffold_3G00239360 Rroxscaffold_3G00239370 Rroxscaffold_3G00239470 Rroxscaffold_3G00239810 Rroxscaffold_3G00251240 Rroxscaffold_4G00289430 Rroxscaffold_4G00289730 Rroxscaffold_4G00312680 Rroxscaffold_4G00312710 Rroxscaffold_4G00315640 Rroxscaffold_4G00316240 Rroxscaffold_4G00316300 Rroxscaffold_4G00317170 Rroxscaffold_4G00317290 Rroxscaffold_4G00321790 Rroxscaffold_4G00322370 Rroxscaffold_4G00330370 Rroxscaffold_4G00331530 Rroxscaffold_4G00332570 Rroxscaffold_5G00338020 Rroxscaffold_5G00339400 Rroxscaffold_5G00344280 Rroxscaffold_5G00345300 Rroxscaffold_5G00346730 Rroxscaffold_5G00359170 Rroxscaffold_5G00370850 Rroxscaffold_5G00371460 Rroxscaffold_5G00380840 Rroxscaffold_6G00389750 Rroxscaffold_6G00389760 Rroxscaffold_6G00390470 Rroxscaffold_6G00390510 Rroxscaffold_6G00390560 Rroxscaffold_6G00390590 Rroxscaffold_6G00391550 Rroxscaffold_6G00391700 Rroxscaffold_6G00398420 Rroxscaffold_7G00183290 Rroxscaffold_7G00184060 Rroxscaffold_7G00191180 Rroxscaffold_7G00193290 Rroxscaffold_7G00195040 Rroxscaffold_7G00196890 Rroxscaffold_7G00199380 Rroxscaffold_7G00199440 Rroxscaffold_7G00201010 Rroxscaffold_7G00202460
rosa_rugosa Rorug04G0280300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 394
AbsI CCTCGAGG 1 cut(s) 294
AccB1I GGYRCC 1 cut(s) 264
AccIII TCCGGA 1 cut(s) 334
AciI CCGC 1 cut(s) 436
AclWI GGATC 1 cut(s) 324
AcsI RAATTY 2 cut(s) 36, 42
AfaI GTAC 1 cut(s) 209
AfiI CCNNNNNNNGG 1 cut(s) 334
AgeI ACCGGT 1 cut(s) 119
AgsI TTSAA 7 cut(s) 41, 47, 142, 193, 253, 289, 346
AluBI AGCT 3 cut(s) 14, 53, 473
AluI AGCT 3 cut(s) 14, 53, 473
Alw26I GTCTC 2 cut(s) 93, 361
AlwI GGATC 1 cut(s) 324
Ama87I CYCGRG 2 cut(s) 294, 426
Aor13HI TCCGGA 1 cut(s) 334
ApoI RAATTY 2 cut(s) 36, 42
AsiGI ACCGGT 1 cut(s) 119
Asp700I GAANNNNTTC 1 cut(s) 397
AsuHPI GGTGA 1 cut(s) 134
AvaI CYCGRG 2 cut(s) 294, 426
BanI GGYRCC 1 cut(s) 264
BbsI GAAGAC 2 cut(s) 241, 390
BceAI ACGGC 2 cut(s) 222, 252
BclI TGATCA 1 cut(s) 76
BcoDI GTCTC 2 cut(s) 93, 361
BfaI CTAG 2 cut(s) 21, 470
BfmI CTRYAG 1 cut(s) 474
BglII AGATCT 1 cut(s) 350
BmcAI AGTACT 1 cut(s) 209
BmeT110I CYCGRG 2 cut(s) 294, 426
BmiI GGNNCC 3 cut(s) 266, 409, 511
BmrI ACTGGG 1 cut(s) 38
BmsI GCATC 2 cut(s) 93, 475
BmuI ACTGGG 1 cut(s) 38
BpiI GAAGAC 2 cut(s) 241, 390
BpuEI CTTGAG 1 cut(s) 305
BsaWI WCCGGW 2 cut(s) 119, 334
Bsc4I CCNNNNNNNGG 1 cut(s) 334
Bse118I RCCGGY 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 33
BseAI TCCGGA 1 cut(s) 334
BseGI GGATG 2 cut(s) 102, 444
BseLI CCNNNNNNNGG 1 cut(s) 334
BseNI ACTGG 1 cut(s) 33
BshNI GGYRCC 1 cut(s) 264
BshTI ACCGGT 1 cut(s) 119
BsiHKCI CYCGRG 2 cut(s) 294, 426
BsiSI CCGG 2 cut(s) 120, 335
BslI CCNNNNNNNGG 1 cut(s) 334
BsmAI GTCTC 2 cut(s) 93, 361
BsoBI CYCGRG 2 cut(s) 294, 426
Bsp13I TCCGGA 1 cut(s) 334
Bsp143I GATC 4 cut(s) 76, 316, 350, 380
BspACI CCGC 1 cut(s) 436
BspEI TCCGGA 1 cut(s) 334
BspLI GGNNCC 3 cut(s) 266, 409, 511
BspPI GGATC 1 cut(s) 324
BspT107I GGYRCC 1 cut(s) 264
BsrFI RCCGGY 1 cut(s) 119
BsrI ACTGG 1 cut(s) 33
BssAI RCCGGY 1 cut(s) 119
BssMI GATC 4 cut(s) 76, 316, 350, 380
Bst4CI ACNGT 2 cut(s) 207, 371
Bst6I CTCTTC 2 cut(s) 91, 176
BstC8I GCNNGC 1 cut(s) 55
BstF5I GGATG 2 cut(s) 102, 444
BstKTI GATC 4 cut(s) 79, 319, 353, 383
BstMAI GTCTC 2 cut(s) 93, 361
BstMBI GATC 4 cut(s) 76, 316, 350, 380
BstMWI GCNNNNNNNGC 2 cut(s) 59, 234
BstNSI RCATGY 1 cut(s) 187
BstSFI CTRYAG 1 cut(s) 474
BstV2I GAAGAC 2 cut(s) 241, 390
BstX2I RGATCY 2 cut(s) 316, 350
BstYI RGATCY 2 cut(s) 316, 350
BtsCI GGATG 2 cut(s) 102, 444
BtsI GCAGTG 1 cut(s) 276
BtsIMutI CAGTG 1 cut(s) 276
Cac8I GCNNGC 1 cut(s) 55
Cfr10I RCCGGY 1 cut(s) 119
Csp6I GTAC 1 cut(s) 208
CspAI ACCGGT 1 cut(s) 119
CviAII CATG 1 cut(s) 184
CviJI RGCY 6 cut(s) 14, 53, 57, 245, 301, 473
CviKI_1 RGCY 6 cut(s) 14, 53, 57, 245, 301, 473
CviQI GTAC 1 cut(s) 208
DpnI GATC 4 cut(s) 78, 318, 352, 382
DpnII GATC 4 cut(s) 76, 316, 350, 380
DrdI GACNNNNNNGTC 1 cut(s) 394
DseDI GACNNNNNNGTC 1 cut(s) 394
Eam1104I CTCTTC 2 cut(s) 91, 176
EarI CTCTTC 2 cut(s) 91, 176
EciI GGCGGA 1 cut(s) 451
Eco32I GATATC 1 cut(s) 132
Eco88I CYCGRG 2 cut(s) 294, 426
EcoRI GAATTC 1 cut(s) 36
EcoRV GATATC 1 cut(s) 132
FaeI CATG 1 cut(s) 187
FaiI YATR 5 cut(s) 136, 165, 185, 217, 374
FalI AAGNNNNNCTT 2 cut(s) 382, 414
FatI CATG 1 cut(s) 183
FbaI TGATCA 1 cut(s) 76
FokI GGATG 2 cut(s) 89, 451
FspBI CTAG 2 cut(s) 21, 470
HapII CCGG 2 cut(s) 120, 335
Hin1II CATG 1 cut(s) 187
HincII GTYRAC 1 cut(s) 203
HindII GTYRAC 1 cut(s) 203
HinfI GANTC 2 cut(s) 289, 342
HpaII CCGG 2 cut(s) 120, 335
HphI GGTGA 1 cut(s) 134
Hpy166II GTNNAC 2 cut(s) 125, 203
Hpy188I TCNGA 3 cut(s) 81, 412, 453
Hpy188III TCNNGA 6 cut(s) 21, 71, 322, 335, 346, 428
Hpy8I GTNNAC 2 cut(s) 125, 203
Hpy99I CGWCG 1 cut(s) 237
HpyAV CCTTC 1 cut(s) 136
HpyCH4III ACNGT 2 cut(s) 207, 371
HpyCH4IV ACGT 1 cut(s) 395
HpyCH4V TGCA 1 cut(s) 187
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 234
HpySE526I ACGT 1 cut(s) 395
Hsp92II CATG 1 cut(s) 187
Kpn2I TCCGGA 1 cut(s) 334
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 4 cut(s) 76, 316, 350, 380
LmnI GCTCC 2 cut(s) 67, 337
LpnPI CCDG 7 cut(s) 14, 39, 78, 133, 271, 348, 492
LweI GCATC 2 cut(s) 93, 475
MaeI CTAG 2 cut(s) 21, 470
MaeII ACGT 1 cut(s) 395
MalI GATC 4 cut(s) 78, 318, 352, 382
MboI GATC 4 cut(s) 76, 316, 350, 380
MboII GAAGA 6 cut(s) 108, 160, 163, 241, 390, 511
MflI RGATCY 2 cut(s) 316, 350
MluCI AATT 3 cut(s) 36, 42, 447
MnlI CCTC 7 cut(s) 213, 290, 303, 378, 426, 428, 489
MroI TCCGGA 1 cut(s) 334
MroXI GAANNNNTTC 1 cut(s) 397
MseI TTAA 1 cut(s) 491
MspI CCGG 2 cut(s) 120, 335
MwoI GCNNNNNNNGC 2 cut(s) 59, 234
NdeII GATC 4 cut(s) 76, 316, 350, 380
NlaIII CATG 1 cut(s) 187
NlaIV GGNNCC 3 cut(s) 266, 409, 511
NspI RCATGY 1 cut(s) 187
PaeR7I CTCGAG 1 cut(s) 294
PdmI GAANNNNTTC 1 cut(s) 397
PfeI GAWTC 2 cut(s) 289, 342
PinAI ACCGGT 1 cut(s) 119
PspN4I GGNNCC 3 cut(s) 266, 409, 511
PspXI VCTCGAGB 1 cut(s) 294
PsuI RGATCY 2 cut(s) 316, 350
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
SaqAI TTAA 1 cut(s) 491
Sau3AI GATC 4 cut(s) 76, 316, 350, 380
ScaI AGTACT 1 cut(s) 209
SetI ASST 7 cut(s) 16, 55, 224, 260, 398, 420, 475
SfaNI GCATC 2 cut(s) 93, 475
SfcI CTRYAG 1 cut(s) 474
Sfr274I CTCGAG 1 cut(s) 294
SgrAI CRCCGGYG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 294
SmlI CTYRAG 2 cut(s) 294, 320
SmoI CTYRAG 2 cut(s) 294, 320
Sse9I AATT 3 cut(s) 36, 42, 447
SsiI CCGC 1 cut(s) 436
SspMI CTAG 2 cut(s) 21, 470
TaaI ACNGT 2 cut(s) 207, 371
TaiI ACGT 1 cut(s) 398
TaqI TCGA 3 cut(s) 295, 364, 383
TasI AATT 3 cut(s) 36, 42, 447
TatI WGTACW 1 cut(s) 207
TfiI GAWTC 2 cut(s) 289, 342
Tru1I TTAA 1 cut(s) 491
Tru9I TTAA 1 cut(s) 491
TscAI CASTG 1 cut(s) 283
TspDTI ATGAA 3 cut(s) 100, 163, 455
TspRI CASTG 1 cut(s) 283
XapI RAATTY 2 cut(s) 36, 42
XbaI TCTAGA 1 cut(s) 20
XceI RCATGY 1 cut(s) 187
XhoI CTCGAG 1 cut(s) 294
XmnI GAANNNNTTC 1 cut(s) 397
XspI CTAG 2 cut(s) 21, 470
ZrmI AGTACT 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.