Rroxscaffold_2G00099730

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000483
Physical Location & Seq
Reverse (-)
21503517 .. 21503825
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00099730.1

Sequence Viewer

Length: 309 bp
ATGAAGGCAATTCGGAACGTTCGAGTTGGTGGATCTCTCGATCTCAACTTTGGATCCACTAGTTCTACCGATGATGGTGGGTCCATTGATCTAAACTTTGGTTCCATTGGTTCCACTGGTGCTGATGGATCTATCGATCTAACTTTTGGGTCAAGTGTCGACTATAATGTTGACCCATATTCCTCCTCACCCTTCAACAATAATATCGTACTACCTCCTTCGGCACAACAGAGGACAAACTTTCATGGAACAATGAGGAGGAGATCACCAGGAGGTCGAAACTCTTCCTCTGTTCCCCGTGCACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

10.7

Weight (kDa)

8.27

Isoelectric Point (pI)

51.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000483)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002132.1_g000009 Rmu_sc0002786.1_g000030
rosa_roxburghii Rroxscaffold_159G00432910 Rroxscaffold_159G00433130 Rroxscaffold_166G00440820 Rroxscaffold_173G00435050 Rroxscaffold_174G00435100 Rroxscaffold_180G00433390 Rroxscaffold_180G00433400 Rroxscaffold_180G00433440 Rroxscaffold_180G00433490 Rroxscaffold_1G00000420 Rroxscaffold_1G00000930 Rroxscaffold_1G00002350 Rroxscaffold_1G00003270 Rroxscaffold_1G00003640 Rroxscaffold_1G00004210 Rroxscaffold_1G00022320 Rroxscaffold_1G00036090 Rroxscaffold_1G00042540 Rroxscaffold_2G00080860 Rroxscaffold_2G00084440 Rroxscaffold_2G00085920 Rroxscaffold_2G00087210 Rroxscaffold_2G00087260 Rroxscaffold_2G00089240 Rroxscaffold_2G00096210 Rroxscaffold_2G00098680 Rroxscaffold_2G00099730 Rroxscaffold_2G00102340 Rroxscaffold_2G00102390 Rroxscaffold_2G00107430 Rroxscaffold_2G00115560 Rroxscaffold_2G00128260 Rroxscaffold_3G00221780 Rroxscaffold_3G00224580 Rroxscaffold_3G00225490 Rroxscaffold_3G00234530 Rroxscaffold_3G00235740 Rroxscaffold_3G00236590 Rroxscaffold_3G00239210 Rroxscaffold_3G00239230 Rroxscaffold_3G00239360 Rroxscaffold_3G00239370 Rroxscaffold_3G00239470 Rroxscaffold_3G00239810 Rroxscaffold_3G00251240 Rroxscaffold_4G00289430 Rroxscaffold_4G00289730 Rroxscaffold_4G00312680 Rroxscaffold_4G00312710 Rroxscaffold_4G00315640 Rroxscaffold_4G00316240 Rroxscaffold_4G00316300 Rroxscaffold_4G00317170 Rroxscaffold_4G00317290 Rroxscaffold_4G00321790 Rroxscaffold_4G00322370 Rroxscaffold_4G00330370 Rroxscaffold_4G00331530 Rroxscaffold_4G00332570 Rroxscaffold_5G00338020 Rroxscaffold_5G00339400 Rroxscaffold_5G00344280 Rroxscaffold_5G00345300 Rroxscaffold_5G00346730 Rroxscaffold_5G00359170 Rroxscaffold_5G00370850 Rroxscaffold_5G00371460 Rroxscaffold_5G00380840 Rroxscaffold_6G00389750 Rroxscaffold_6G00389760 Rroxscaffold_6G00390470 Rroxscaffold_6G00390510 Rroxscaffold_6G00390560 Rroxscaffold_6G00390590 Rroxscaffold_6G00391550 Rroxscaffold_6G00391700 Rroxscaffold_6G00398420 Rroxscaffold_7G00183290 Rroxscaffold_7G00184060 Rroxscaffold_7G00191180 Rroxscaffold_7G00193290 Rroxscaffold_7G00195040 Rroxscaffold_7G00196890 Rroxscaffold_7G00199380 Rroxscaffold_7G00199440 Rroxscaffold_7G00201010 Rroxscaffold_7G00202460
rosa_rugosa Rorug04G0280300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 159
AclI AACGTT 1 cut(s) 18
AclWI GGATC 4 cut(s) 40, 48, 61, 136
AfaI GTAC 1 cut(s) 210
AgsI TTSAA 1 cut(s) 196
AhlI ACTAGT 1 cut(s) 59
AjnI CCWGG 1 cut(s) 268
Alw21I GWGCWC 1 cut(s) 304
Alw44I GTGCAC 1 cut(s) 300
AlwI GGATC 4 cut(s) 40, 48, 61, 136
ApaLI GTGCAC 1 cut(s) 300
Asp700I GAANNNNTTC 1 cut(s) 283
AspS9I GGNCC 1 cut(s) 81
AsuHPI GGTGA 2 cut(s) 180, 258
AvaII GGWCC 1 cut(s) 81
BaeGI GKGCMC 1 cut(s) 304
BamHI GGATCC 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 304
BccI CCATC 2 cut(s) 68, 119
BciT130I CCWGG 1 cut(s) 270
BcuI ACTAGT 1 cut(s) 59
BfaI CTAG 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 270
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmiI GGNNCC 4 cut(s) 55, 82, 103, 112
BmrFI CCNGG 1 cut(s) 270
Bsa29I ATCGAT 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 270
BseCI ATCGAT 1 cut(s) 135
BseNI ACTGG 1 cut(s) 121
BseRI GAGGAG 3 cut(s) 175, 271, 274
BseSI GKGCMC 1 cut(s) 304
BshVI ATCGAT 1 cut(s) 135
BsiHKAI GWGCWC 1 cut(s) 304
Bsp1286I GDGCHC 1 cut(s) 304
Bsp143I GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
BspDI ATCGAT 1 cut(s) 135
BspLI GGNNCC 4 cut(s) 55, 82, 103, 112
BspPI GGATC 4 cut(s) 40, 48, 61, 136
BsrI ACTGG 1 cut(s) 121
BssMI GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
Bst2UI CCWGG 1 cut(s) 270
Bst4CI ACNGT 1 cut(s) 306
Bst6I CTCTTC 1 cut(s) 289
BstKTI GATC 7 cut(s) 35, 43, 56, 91, 131, 139, 266
BstMBI GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
BstNI CCWGG 1 cut(s) 270
BstSCI CCNGG 1 cut(s) 268
BstSLI GKGCMC 1 cut(s) 304
BstX2I RGATCY 3 cut(s) 32, 53, 128
BstYI RGATCY 3 cut(s) 32, 53, 128
Bsu15I ATCGAT 1 cut(s) 135
BsuTUI ATCGAT 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 81
ClaI ATCGAT 1 cut(s) 135
Csp6I GTAC 1 cut(s) 209
CviAII CATG 1 cut(s) 245
CviQI GTAC 1 cut(s) 209
DpnI GATC 7 cut(s) 34, 42, 55, 90, 130, 138, 265
DpnII GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
Eam1104I CTCTTC 1 cut(s) 289
EarI CTCTTC 1 cut(s) 289
Eco47I GGWCC 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 268
FaeI CATG 1 cut(s) 248
FaiI YATR 3 cut(s) 165, 178, 246
FatI CATG 1 cut(s) 244
FblI GTMKAC 1 cut(s) 159
FspBI CTAG 1 cut(s) 60
Hin1II CATG 1 cut(s) 248
HincII GTYRAC 2 cut(s) 160, 172
HindII GTYRAC 2 cut(s) 160, 172
HphI GGTGA 2 cut(s) 180, 258
Hpy166II GTNNAC 3 cut(s) 160, 172, 302
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 3 cut(s) 160, 172, 302
HpyAV CCTTC 2 cut(s) 202, 228
HpyCH4III ACNGT 1 cut(s) 306
HpyCH4IV ACGT 1 cut(s) 18
HpyCH4V TGCA 1 cut(s) 302
HpySE526I ACGT 1 cut(s) 18
Hsp92II CATG 1 cut(s) 248
Kzo9I GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
LpnPI CCDG 3 cut(s) 102, 255, 282
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 18
MalI GATC 7 cut(s) 34, 42, 55, 90, 130, 138, 265
MboI GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
MboII GAAGA 1 cut(s) 276
MflI RGATCY 3 cut(s) 32, 53, 128
MhlI GDGCHC 1 cut(s) 304
MluCI AATT 1 cut(s) 9
MnlI CCTC 8 cut(s) 193, 196, 225, 225, 249, 252, 266, 298
MroXI GAANNNNTTC 1 cut(s) 283
MspR9I CCNGG 1 cut(s) 270
MvaI CCWGG 1 cut(s) 270
NdeII GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
NlaIII CATG 1 cut(s) 248
NlaIV GGNNCC 4 cut(s) 55, 82, 103, 112
PcsI WCGNNNNNNNCGW 1 cut(s) 19
PdmI GAANNNNTTC 1 cut(s) 283
Psp1406I AACGTT 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 268
PspGI CCWGG 1 cut(s) 268
PspN4I GGNNCC 4 cut(s) 55, 82, 103, 112
PspPI GGNCC 1 cut(s) 81
PsuI RGATCY 3 cut(s) 32, 53, 128
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
SalI GTCGAC 1 cut(s) 158
Sau3AI GATC 7 cut(s) 32, 40, 53, 88, 128, 136, 263
Sau96I GGNCC 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 270
SduI GDGCHC 1 cut(s) 304
SetI ASST 3 cut(s) 21, 217, 277
SgeI CNNG 8 cut(s) 35, 50, 72, 129, 165, 257, 281, 282
SinI GGWCC 1 cut(s) 81
SpeI ACTAGT 1 cut(s) 59
Sse9I AATT 1 cut(s) 9
SspMI CTAG 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 306
TaiI ACGT 1 cut(s) 21
TaqI TCGA 5 cut(s) 22, 39, 135, 159, 277
TasI AATT 1 cut(s) 9
TscAI CASTG 1 cut(s) 121
TspDTI ATGAA 2 cut(s) 17, 233
TspRI CASTG 1 cut(s) 121
VneI GTGCAC 1 cut(s) 300
VpaK11BI GGWCC 1 cut(s) 81
XmiI GTMKAC 1 cut(s) 159
XmnI GAANNNNTTC 1 cut(s) 283
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.