Rroxscaffold_7G00199380

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000483
Physical Location & Seq
Forward (+)
45931153 .. 45931461
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00199380.1

Sequence Viewer

Length: 309 bp
ATGAGGTTAATCCGATATGTTCGGGTTGGTGGATCTCTCGATCTCAATTTTGGATCCACTAGTTCTACCGATGATGGTGGGTCAATTAATCTAAACTTTGGTTCCGTTGGTTCTACCGGTGATGATGGATCCGTCGATTTAACTTTTGGGTCATGGGTCGGCCATAGTGTTGACCCATATTCCTCCTTACCCTTCAACACTAATACTAGTACTACCTCCTTTGGCACAACGGAGGACAAACTTCCATGGAACAACGAGGAGGAGATCACCGGAGGTCGAAACTCTTCCTCTGTTCCCCTTGCACGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

10.77

Weight (kDa)

4.35

Isoelectric Point (pI)

26.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000483)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002132.1_g000009 Rmu_sc0002786.1_g000030
rosa_roxburghii Rroxscaffold_159G00432910 Rroxscaffold_159G00433130 Rroxscaffold_166G00440820 Rroxscaffold_173G00435050 Rroxscaffold_174G00435100 Rroxscaffold_180G00433390 Rroxscaffold_180G00433400 Rroxscaffold_180G00433440 Rroxscaffold_180G00433490 Rroxscaffold_1G00000420 Rroxscaffold_1G00000930 Rroxscaffold_1G00002350 Rroxscaffold_1G00003270 Rroxscaffold_1G00003640 Rroxscaffold_1G00004210 Rroxscaffold_1G00022320 Rroxscaffold_1G00036090 Rroxscaffold_1G00042540 Rroxscaffold_2G00080860 Rroxscaffold_2G00084440 Rroxscaffold_2G00085920 Rroxscaffold_2G00087210 Rroxscaffold_2G00087260 Rroxscaffold_2G00089240 Rroxscaffold_2G00096210 Rroxscaffold_2G00098680 Rroxscaffold_2G00099730 Rroxscaffold_2G00102340 Rroxscaffold_2G00102390 Rroxscaffold_2G00107430 Rroxscaffold_2G00115560 Rroxscaffold_2G00128260 Rroxscaffold_3G00221780 Rroxscaffold_3G00224580 Rroxscaffold_3G00225490 Rroxscaffold_3G00234530 Rroxscaffold_3G00235740 Rroxscaffold_3G00236590 Rroxscaffold_3G00239210 Rroxscaffold_3G00239230 Rroxscaffold_3G00239360 Rroxscaffold_3G00239370 Rroxscaffold_3G00239470 Rroxscaffold_3G00239810 Rroxscaffold_3G00251240 Rroxscaffold_4G00289430 Rroxscaffold_4G00289730 Rroxscaffold_4G00312680 Rroxscaffold_4G00312710 Rroxscaffold_4G00315640 Rroxscaffold_4G00316240 Rroxscaffold_4G00316300 Rroxscaffold_4G00317170 Rroxscaffold_4G00317290 Rroxscaffold_4G00321790 Rroxscaffold_4G00322370 Rroxscaffold_4G00330370 Rroxscaffold_4G00331530 Rroxscaffold_4G00332570 Rroxscaffold_5G00338020 Rroxscaffold_5G00339400 Rroxscaffold_5G00344280 Rroxscaffold_5G00345300 Rroxscaffold_5G00346730 Rroxscaffold_5G00359170 Rroxscaffold_5G00370850 Rroxscaffold_5G00371460 Rroxscaffold_5G00380840 Rroxscaffold_6G00389750 Rroxscaffold_6G00389760 Rroxscaffold_6G00390470 Rroxscaffold_6G00390510 Rroxscaffold_6G00390560 Rroxscaffold_6G00390590 Rroxscaffold_6G00391550 Rroxscaffold_6G00391700 Rroxscaffold_6G00398420 Rroxscaffold_7G00183290 Rroxscaffold_7G00184060 Rroxscaffold_7G00191180 Rroxscaffold_7G00193290 Rroxscaffold_7G00195040 Rroxscaffold_7G00196890 Rroxscaffold_7G00199380 Rroxscaffold_7G00199440 Rroxscaffold_7G00201010 Rroxscaffold_7G00202460
rosa_rugosa Rorug04G0280300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 40, 48, 61, 123, 136
AcoI YGGCCR 1 cut(s) 160
AfaI GTAC 1 cut(s) 211
AfiI CCNNNNNNNGG 1 cut(s) 303
AgeI ACCGGT 1 cut(s) 116
AgsI TTSAA 1 cut(s) 196
AhlI ACTAGT 2 cut(s) 59, 206
AlwI GGATC 5 cut(s) 40, 48, 61, 123, 136
AoxI GGCC 1 cut(s) 160
AseI ATTAAT 1 cut(s) 87
AsiGI ACCGGT 1 cut(s) 116
Asp700I GAANNNNTTC 1 cut(s) 283
AsuHPI GGTGA 2 cut(s) 131, 259
BamHI GGATCC 2 cut(s) 53, 128
BccI CCATC 2 cut(s) 68, 119
BcuI ACTAGT 2 cut(s) 59, 206
BfaI CTAG 2 cut(s) 60, 207
BmcAI AGTACT 1 cut(s) 211
BmiI GGNNCC 3 cut(s) 55, 103, 130
BsaJI CCNNGG 1 cut(s) 245
BsaWI WCCGGW 2 cut(s) 116, 269
Bsc4I CCNNNNNNNGG 1 cut(s) 303
Bse118I RCCGGY 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 245
BseLI CCNNNNNNNGG 1 cut(s) 303
BseRI GAGGAG 2 cut(s) 272, 275
BshFI GGCC 1 cut(s) 162
BshTI ACCGGT 1 cut(s) 116
BsiSI CCGG 2 cut(s) 117, 270
BslI CCNNNNNNNGG 1 cut(s) 303
BsnI GGCC 1 cut(s) 162
Bsp143I GATC 5 cut(s) 32, 40, 53, 128, 264
Bsp19I CCATGG 1 cut(s) 245
BspANI GGCC 1 cut(s) 162
BspLI GGNNCC 3 cut(s) 55, 103, 130
BspPI GGATC 5 cut(s) 40, 48, 61, 123, 136
BsrFI RCCGGY 1 cut(s) 116
BssAI RCCGGY 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 245
BssMI GATC 5 cut(s) 32, 40, 53, 128, 264
BssT1I CCWWGG 1 cut(s) 245
Bst4CI ACNGT 1 cut(s) 306
Bst6I CTCTTC 1 cut(s) 289
BstDSI CCRYGG 1 cut(s) 245
BstKTI GATC 5 cut(s) 35, 43, 56, 131, 267
BstMBI GATC 5 cut(s) 32, 40, 53, 128, 264
BstX2I RGATCY 3 cut(s) 32, 53, 128
BstYI RGATCY 3 cut(s) 32, 53, 128
BsuRI GGCC 1 cut(s) 162
BtgI CCRYGG 1 cut(s) 245
Cfr10I RCCGGY 1 cut(s) 116
Csp6I GTAC 1 cut(s) 210
CspAI ACCGGT 1 cut(s) 116
CviAII CATG 2 cut(s) 153, 246
CviJI RGCY 1 cut(s) 162
CviKI_1 RGCY 1 cut(s) 162
CviQI GTAC 1 cut(s) 210
DpnI GATC 5 cut(s) 34, 42, 55, 130, 266
DpnII GATC 5 cut(s) 32, 40, 53, 128, 264
EaeI YGGCCR 1 cut(s) 160
Eam1104I CTCTTC 1 cut(s) 289
EarI CTCTTC 1 cut(s) 289
Eco130I CCWWGG 1 cut(s) 245
EcoT14I CCWWGG 1 cut(s) 245
ErhI CCWWGG 1 cut(s) 245
FaeI CATG 2 cut(s) 156, 249
FaiI YATR 5 cut(s) 18, 154, 165, 178, 247
FatI CATG 2 cut(s) 152, 245
FspBI CTAG 2 cut(s) 60, 207
HaeIII GGCC 1 cut(s) 162
HapII CCGG 2 cut(s) 117, 270
Hin1II CATG 2 cut(s) 156, 249
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HpaII CCGG 2 cut(s) 117, 270
HphI GGTGA 2 cut(s) 131, 259
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 14
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 172
Hpy99I CGWCG 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 306
HpyCH4V TGCA 1 cut(s) 302
Hsp92II CATG 2 cut(s) 156, 249
Kzo9I GATC 5 cut(s) 32, 40, 53, 128, 264
LpnPI CCDG 2 cut(s) 130, 283
MaeI CTAG 2 cut(s) 60, 207
MalI GATC 5 cut(s) 34, 42, 55, 130, 266
MboI GATC 5 cut(s) 32, 40, 53, 128, 264
MboII GAAGA 1 cut(s) 276
MflI RGATCY 3 cut(s) 32, 53, 128
MluCI AATT 2 cut(s) 46, 84
MnlI CCTC 7 cut(s) 193, 226, 226, 250, 253, 266, 298
MroXI GAANNNNTTC 1 cut(s) 283
MseI TTAA 3 cut(s) 8, 87, 140
MspI CCGG 2 cut(s) 117, 270
NcoI CCATGG 1 cut(s) 245
NdeII GATC 5 cut(s) 32, 40, 53, 128, 264
NlaIII CATG 2 cut(s) 156, 249
NlaIV GGNNCC 3 cut(s) 55, 103, 130
PdmI GAANNNNTTC 1 cut(s) 283
PinAI ACCGGT 1 cut(s) 116
PshBI ATTAAT 1 cut(s) 87
PspN4I GGNNCC 3 cut(s) 55, 103, 130
PsuI RGATCY 3 cut(s) 32, 53, 128
RsaI GTAC 1 cut(s) 211
RsaNI GTAC 1 cut(s) 210
SaqAI TTAA 3 cut(s) 8, 87, 140
Sau3AI GATC 5 cut(s) 32, 40, 53, 128, 264
ScaI AGTACT 1 cut(s) 211
SetI ASST 3 cut(s) 8, 218, 277
SgeI CNNG 9 cut(s) 35, 50, 72, 129, 165, 219, 258, 268, 282
SpeI ACTAGT 2 cut(s) 59, 206
Sse9I AATT 2 cut(s) 46, 84
SspMI CTAG 2 cut(s) 60, 207
StyI CCWWGG 1 cut(s) 245
TaaI ACNGT 1 cut(s) 306
TaqI TCGA 3 cut(s) 39, 135, 277
TasI AATT 2 cut(s) 46, 84
TatI WGTACW 1 cut(s) 209
Tru1I TTAA 3 cut(s) 8, 87, 140
Tru9I TTAA 3 cut(s) 8, 87, 140
TspGWI ACGGA 3 cut(s) 94, 121, 245
VspI ATTAAT 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 283
XspI CTAG 2 cut(s) 60, 207
ZrmI AGTACT 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.