Rroxscaffold_7G00196890

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000483
Physical Location & Seq
Reverse (-)
40347147 .. 40372403
25257 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00196890.1

Sequence Viewer

Length: 282 bp
ATGGGTGGTGGTGCTGCCACTGTGATGGTTCGAAGAATCAGAGTAATGATCGAGTGGATCAGAGTGCTGATGGATTTAGACGTTGATGGTTCGTTTGAGAAGAATCAGAGCAGTGATCGTGCAGATCAGAATTCTGTTGGATTGAAGAATATAAGTCAATACAATGCCCGCTCCCTCAAGGCCATCACAGACCTCAACCACAGCATCACCGTCCTCTCTGTGGGCCACGCTCCATCAACACAGACGGCTCCTCAAGTTTTTCCGCTTGGGTTCGCAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.13

Weight (kDa)

6.72

Isoelectric Point (pI)

39.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000483)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002132.1_g000009 Rmu_sc0002786.1_g000030
rosa_roxburghii Rroxscaffold_159G00432910 Rroxscaffold_159G00433130 Rroxscaffold_166G00440820 Rroxscaffold_173G00435050 Rroxscaffold_174G00435100 Rroxscaffold_180G00433390 Rroxscaffold_180G00433400 Rroxscaffold_180G00433440 Rroxscaffold_180G00433490 Rroxscaffold_1G00000420 Rroxscaffold_1G00000930 Rroxscaffold_1G00002350 Rroxscaffold_1G00003270 Rroxscaffold_1G00003640 Rroxscaffold_1G00004210 Rroxscaffold_1G00022320 Rroxscaffold_1G00036090 Rroxscaffold_1G00042540 Rroxscaffold_2G00080860 Rroxscaffold_2G00084440 Rroxscaffold_2G00085920 Rroxscaffold_2G00087210 Rroxscaffold_2G00087260 Rroxscaffold_2G00089240 Rroxscaffold_2G00096210 Rroxscaffold_2G00098680 Rroxscaffold_2G00099730 Rroxscaffold_2G00102340 Rroxscaffold_2G00102390 Rroxscaffold_2G00107430 Rroxscaffold_2G00115560 Rroxscaffold_2G00128260 Rroxscaffold_3G00221780 Rroxscaffold_3G00224580 Rroxscaffold_3G00225490 Rroxscaffold_3G00234530 Rroxscaffold_3G00235740 Rroxscaffold_3G00236590 Rroxscaffold_3G00239210 Rroxscaffold_3G00239230 Rroxscaffold_3G00239360 Rroxscaffold_3G00239370 Rroxscaffold_3G00239470 Rroxscaffold_3G00239810 Rroxscaffold_3G00251240 Rroxscaffold_4G00289430 Rroxscaffold_4G00289730 Rroxscaffold_4G00312680 Rroxscaffold_4G00312710 Rroxscaffold_4G00315640 Rroxscaffold_4G00316240 Rroxscaffold_4G00316300 Rroxscaffold_4G00317170 Rroxscaffold_4G00317290 Rroxscaffold_4G00321790 Rroxscaffold_4G00322370 Rroxscaffold_4G00330370 Rroxscaffold_4G00331530 Rroxscaffold_4G00332570 Rroxscaffold_5G00338020 Rroxscaffold_5G00339400 Rroxscaffold_5G00344280 Rroxscaffold_5G00345300 Rroxscaffold_5G00346730 Rroxscaffold_5G00359170 Rroxscaffold_5G00370850 Rroxscaffold_5G00371460 Rroxscaffold_5G00380840 Rroxscaffold_6G00389750 Rroxscaffold_6G00389760 Rroxscaffold_6G00390470 Rroxscaffold_6G00390510 Rroxscaffold_6G00390560 Rroxscaffold_6G00390590 Rroxscaffold_6G00391550 Rroxscaffold_6G00391700 Rroxscaffold_6G00398420 Rroxscaffold_7G00183290 Rroxscaffold_7G00184060 Rroxscaffold_7G00191180 Rroxscaffold_7G00193290 Rroxscaffold_7G00195040 Rroxscaffold_7G00196890 Rroxscaffold_7G00199380 Rroxscaffold_7G00199440 Rroxscaffold_7G00201010 Rroxscaffold_7G00202460
rosa_rugosa Rorug04G0280300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 171
AciI CCGC 2 cut(s) 169, 263
AclWI GGATC 1 cut(s) 65
AcsI RAATTY 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 220
AgsI TTSAA 1 cut(s) 145
AlwI GGATC 1 cut(s) 65
AoxI GGCC 2 cut(s) 180, 223
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 1 cut(s) 130
AspS9I GGNCC 1 cut(s) 223
AsuHPI GGTGA 1 cut(s) 199
AsuII TTCGAA 1 cut(s) 31
BccI CCATC 5 cut(s) 19, 64, 80, 191, 241
BceAI ACGGC 1 cut(s) 261
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 249
BmsI GCATC 1 cut(s) 213
Bpu14I TTCGAA 1 cut(s) 31
BpuEI CTTGAG 2 cut(s) 161, 237
Bsc4I CCNNNNNNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 220
BseRI GAGGAG 1 cut(s) 240
BsgI GTGCAG 1 cut(s) 141
BshFI GGCC 2 cut(s) 182, 225
BslI CCNNNNNNNGG 1 cut(s) 220
BsnI GGCC 2 cut(s) 182, 225
Bsp119I TTCGAA 1 cut(s) 31
Bsp143I GATC 4 cut(s) 48, 57, 115, 124
BspACI CCGC 2 cut(s) 169, 263
BspANI GGCC 2 cut(s) 182, 225
BspLI GGNNCC 1 cut(s) 249
BspPI GGATC 1 cut(s) 65
BspT104I TTCGAA 1 cut(s) 31
BsrBI CCGCTC 1 cut(s) 171
BssMI GATC 4 cut(s) 48, 57, 115, 124
Bst4CI ACNGT 2 cut(s) 22, 211
BstBI TTCGAA 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 169
BstKTI GATC 4 cut(s) 51, 60, 118, 127
BstMBI GATC 4 cut(s) 48, 57, 115, 124
BstXI CCANNNNNNTGG 1 cut(s) 25
BsuRI GGCC 2 cut(s) 182, 225
BtsI GCAGTG 1 cut(s) 118
BtsIMutI CAGTG 2 cut(s) 18, 118
Cac8I GCNNGC 1 cut(s) 169
Cfr13I GGNCC 1 cut(s) 223
CviJI RGCY 3 cut(s) 182, 225, 248
CviKI_1 RGCY 3 cut(s) 182, 225, 248
DpnI GATC 4 cut(s) 50, 59, 117, 126
DpnII GATC 4 cut(s) 48, 57, 115, 124
EcoRI GAATTC 1 cut(s) 130
FaiI YATR 1 cut(s) 152
FauI CCCGC 1 cut(s) 176
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 15
HaeIII GGCC 2 cut(s) 182, 225
HinfI GANTC 2 cut(s) 36, 103
HphI GGTGA 1 cut(s) 199
Hpy188I TCNGA 4 cut(s) 41, 62, 108, 129
HpyCH4III ACNGT 2 cut(s) 22, 211
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 122
HpySE526I ACGT 1 cut(s) 81
Kzo9I GATC 4 cut(s) 48, 57, 115, 124
LmnI GCTCC 3 cut(s) 176, 235, 253
LweI GCATC 1 cut(s) 213
MaeII ACGT 1 cut(s) 81
MalI GATC 4 cut(s) 50, 59, 117, 126
MbiI CCGCTC 1 cut(s) 171
MboI GATC 4 cut(s) 48, 57, 115, 124
MboII GAAGA 3 cut(s) 45, 112, 157
MluCI AATT 1 cut(s) 130
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 4 cut(s) 185, 203, 224, 261
MslI CAYNNNNRTG 1 cut(s) 23
NdeII GATC 4 cut(s) 48, 57, 115, 124
NlaIV GGNNCC 1 cut(s) 249
NspV TTCGAA 1 cut(s) 31
PfeI GAWTC 2 cut(s) 36, 103
PkrI GCNGC 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 249
PspPI GGNCC 1 cut(s) 223
RseI CAYNNNNRTG 1 cut(s) 23
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 4 cut(s) 48, 57, 115, 124
Sau96I GGNCC 1 cut(s) 223
SetI ASST 2 cut(s) 84, 195
SfaNI GCATC 1 cut(s) 213
SfuI TTCGAA 1 cut(s) 31
SgeI CNNG 7 cut(s) 64, 131, 180, 190, 239, 266, 278
SmiMI CAYNNNNRTG 1 cut(s) 23
SmlI CTYRAG 2 cut(s) 176, 252
SmoI CTYRAG 2 cut(s) 176, 252
Sse9I AATT 1 cut(s) 130
SsiI CCGC 2 cut(s) 169, 263
TaaI ACNGT 2 cut(s) 22, 211
TaiI ACGT 1 cut(s) 84
TaqI TCGA 2 cut(s) 31, 51
TasI AATT 1 cut(s) 130
TfiI GAWTC 2 cut(s) 36, 103
TscAI CASTG 2 cut(s) 25, 118
TseI GCWGC 1 cut(s) 14
TspRI CASTG 2 cut(s) 25, 118
XapI RAATTY 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.