Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000005

Orthogroup ID

OG0000322

Physical Location & Seq

Genomic Coordinates Forward (+)

62451360 .. 62452126

Gene Structure 767 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug05G0451700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGATGTTCAGTTTGATCATTAAGAAGCGTTCTAACTGGTGGTTACAGATCGATTGTGATGTAATGATGGAATGGGCCAACTTCACAGAAAGAATGGGGACTTTAAAGTATGAAAACGAAGTAACTAGCAGATTCATCCACAGATCCATGGTGGAGTTGGTTTTGTGTTTAGGATCGGAGTTGGAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001763 GO:0003006 GO:0003674 GO:0003700 GO:0006355 GO:0007275 GO:0008150 GO:0009653 GO:0009791 GO:0009888 GO:0009889 GO:0009908 GO:0009933 GO:0009987 GO:0010014 GO:0010016 GO:0010223 GO:0010346 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0019827 GO:0022412 GO:0022414 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0032504 GO:0048367 GO:0048437 GO:0048438 GO:0048443 GO:0048466 GO:0048507 GO:0048532 GO:0048608 GO:0048646 GO:0048653 GO:0048731 GO:0048827 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0061458 GO:0065007 GO:0080090 GO:0080166 GO:0090506 GO:0090567 GO:0098727 GO:0099402 GO:0140110 GO:1903506 GO:1905393 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox

Protein Analysis

62

Amino Acids

7.49

Weight (kDa)

5.3

Isoelectric Point (pI)

37.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000322)

Species	Orthologous Gene IDs
rosa_rugosa	Rorug01G0045800 Rorug01G0060200 Rorug01G0078200 Rorug01G0080300 Rorug01G0080500 Rorug01G0093600 Rorug01G0096100 Rorug01G0138500.1 Rorug01G0147900.1 Rorug01G0156300.1 Rorug01G0181600 Rorug01G0183600 Rorug01G0183600 Rorug01G0196000 Rorug01G0206200 Rorug01G0206200 Rorug01G0206300 Rorug01G0206400 Rorug01G0245700 Rorug01G0267300 Rorug01G0268000 Rorug01G0324700 Rorug01G0324800 Rorug02G0034400 Rorug02G0034500 Rorug02G0104900 Rorug02G0224800 Rorug02G0224900 Rorug02G0247400 Rorug02G0261500 Rorug02G0288300 Rorug02G0297300 Rorug02G0297400 Rorug02G0314900 Rorug02G0362700 Rorug02G0438500 Rorug02G0438600 Rorug02G0438700 Rorug02G0438800 Rorug02G0525300 Rorug02G0540100 Rorug03G0147100 Rorug03G0150900 Rorug03G0171600 Rorug03G0182000 Rorug03G0200200 Rorug03G0201100 Rorug03G0218400 Rorug03G0218700 Rorug03G0268200 Rorug03G0285500 Rorug03G0296600 Rorug03G0296700 Rorug03G0296800 Rorug03G0341800 Rorug03G0347200 Rorug03G0356300 Rorug04G0029100 Rorug04G0036300 Rorug04G0046500 Rorug04G0070100 Rorug04G0098900 Rorug04G0104400 Rorug04G0167800 Rorug04G0209300 Rorug04G0210700 Rorug04G0210800 Rorug04G0212500 Rorug05G0109400 Rorug05G0148500 Rorug05G0148800 Rorug05G0160200 Rorug05G0184600 Rorug05G0206100 Rorug05G0208500 Rorug05G0208500 Rorug05G0209500 Rorug05G0235800 Rorug05G0239200 Rorug05G0301100 Rorug05G0427000 Rorug05G0451700 Rorug05G0462300 Rorug05G0467300 Rorug05G0524100 Rorug05G0527400 Rorug05G0527500 Rorug05G0561800 Rorug05G0567700 Rorug05G0574200 Rorug06G0000900 Rorug06G0018700.1 Rorug06G0025100 Rorug06G0025200 Rorug06G0025500 Rorug06G0041300 Rorug06G0048100 Rorug06G0050800 Rorug06G0053900 Rorug06G0075200 Rorug06G0080600 Rorug06G0087500.1 Rorug06G0090000 Rorug06G0141200 Rorug06G0218300 Rorug07G0106700 Rorug07G0125500 Rorug07G0185500 Rorug07G0194000 Rorug07G0196600 Rorug07G0200600 Rorug07G0217300 Rorug07G0250300 Rorug07G0301900 Rorug07G0309100.1

Species

Orthologous Gene IDs

rosa_rugosa

Rorug01G0045800 Rorug01G0060200 Rorug01G0078200 Rorug01G0080300 Rorug01G0080500 Rorug01G0093600 Rorug01G0096100 Rorug01G0138500.1 Rorug01G0147900.1 Rorug01G0156300.1 Rorug01G0181600 Rorug01G0183600 Rorug01G0183600 Rorug01G0196000 Rorug01G0206200 Rorug01G0206200 Rorug01G0206300 Rorug01G0206400 Rorug01G0245700 Rorug01G0267300 Rorug01G0268000 Rorug01G0324700 Rorug01G0324800 Rorug02G0034400 Rorug02G0034500 Rorug02G0104900 Rorug02G0224800 Rorug02G0224900 Rorug02G0247400 Rorug02G0261500 Rorug02G0288300 Rorug02G0297300 Rorug02G0297400 Rorug02G0314900 Rorug02G0362700 Rorug02G0438500 Rorug02G0438600 Rorug02G0438700 Rorug02G0438800 Rorug02G0525300 Rorug02G0540100 Rorug03G0147100 Rorug03G0150900 Rorug03G0171600 Rorug03G0182000 Rorug03G0200200 Rorug03G0201100 Rorug03G0218400 Rorug03G0218700 Rorug03G0268200 Rorug03G0285500 Rorug03G0296600 Rorug03G0296700 Rorug03G0296800 Rorug03G0341800 Rorug03G0347200 Rorug03G0356300 Rorug04G0029100 Rorug04G0036300 Rorug04G0046500 Rorug04G0070100 Rorug04G0098900 Rorug04G0104400 Rorug04G0167800 Rorug04G0209300 Rorug04G0210700 Rorug04G0210800 Rorug04G0212500 Rorug05G0109400 Rorug05G0148500 Rorug05G0148800 Rorug05G0160200 Rorug05G0184600 Rorug05G0206100 Rorug05G0208500 Rorug05G0208500 Rorug05G0209500 Rorug05G0235800 Rorug05G0239200 Rorug05G0301100 Rorug05G0427000 Rorug05G0451700 Rorug05G0462300 Rorug05G0467300 Rorug05G0524100 Rorug05G0527400 Rorug05G0527500 Rorug05G0561800 Rorug05G0567700 Rorug05G0574200 Rorug06G0000900 Rorug06G0018700.1 Rorug06G0025100 Rorug06G0025200 Rorug06G0025500 Rorug06G0041300 Rorug06G0048100 Rorug06G0050800 Rorug06G0053900 Rorug06G0075200 Rorug06G0080600 Rorug06G0087500.1 Rorug06G0090000 Rorug06G0141200 Rorug06G0218300 Rorug07G0106700 Rorug07G0125500 Rorug07G0185500 Rorug07G0194000 Rorug07G0196600 Rorug07G0200600 Rorug07G0217300 Rorug07G0250300 Rorug07G0301900 Rorug07G0309100.1

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	138, 181
AlwI	GGATC	2 cut(s)	138, 181
AoxI	GGCC	1 cut(s)	75
AspS9I	GGNCC	1 cut(s)	75
BccI	CCATC	1 cut(s)	61
BclI	TGATCA	1 cut(s)	15
BfaI	CTAG	1 cut(s)	126
BmgT120I	GGNCC	1 cut(s)	75
Bsa29I	ATCGAT	1 cut(s)	51
BsaJI	CCNNGG	1 cut(s)	147
Bse1I	ACTGG	1 cut(s)	41
BseCI	ATCGAT	1 cut(s)	51
BseDI	CCNNGG	1 cut(s)	147
BseGI	GGATG	1 cut(s)	135
BseNI	ACTGG	1 cut(s)	41
BshFI	GGCC	1 cut(s)	77
BshVI	ATCGAT	1 cut(s)	51
BslFI	GGGAC	1 cut(s)	112
BsmFI	GGGAC	1 cut(s)	112
BsnI	GGCC	1 cut(s)	77
Bsp143I	GATC	4 cut(s)	15, 48, 143, 173
Bsp19I	CCATGG	1 cut(s)	147
BspANI	GGCC	1 cut(s)	77
BspDI	ATCGAT	1 cut(s)	51
BspPI	GGATC	2 cut(s)	138, 181
BsrI	ACTGG	1 cut(s)	41
BssECI	CCNNGG	1 cut(s)	147
BssMI	GATC	4 cut(s)	15, 48, 143, 173
BssT1I	CCWWGG	1 cut(s)	147
BstDSI	CCRYGG	1 cut(s)	147
BstF5I	GGATG	1 cut(s)	135
BstKTI	GATC	4 cut(s)	18, 51, 146, 176
BstMBI	GATC	4 cut(s)	15, 48, 143, 173
BstX2I	RGATCY	1 cut(s)	143
BstYI	RGATCY	1 cut(s)	143
Bsu15I	ATCGAT	1 cut(s)	51
BsuRI	GGCC	1 cut(s)	77
BsuTUI	ATCGAT	1 cut(s)	51
BtgI	CCRYGG	1 cut(s)	147
BtsCI	GGATG	1 cut(s)	135
Cfr13I	GGNCC	1 cut(s)	75
ClaI	ATCGAT	1 cut(s)	51
CviAII	CATG	1 cut(s)	148
CviJI	RGCY	1 cut(s)	77
CviKI_1	RGCY	1 cut(s)	77
DpnI	GATC	4 cut(s)	17, 50, 145, 175
DpnII	GATC	4 cut(s)	15, 48, 143, 173
DraI	TTTAAA	1 cut(s)	105
Eco130I	CCWWGG	1 cut(s)	147
EcoT14I	CCWWGG	1 cut(s)	147
ErhI	CCWWGG	1 cut(s)	147
FaeI	CATG	1 cut(s)	151
FaiI	YATR	2 cut(s)	111, 149
FaqI	GGGAC	1 cut(s)	112
FatI	CATG	1 cut(s)	147
FbaI	TGATCA	1 cut(s)	15
FokI	GGATG	1 cut(s)	122
FspBI	CTAG	1 cut(s)	126
HaeIII	GGCC	1 cut(s)	77
Hin1II	CATG	1 cut(s)	151
HinfI	GANTC	1 cut(s)	132
Hpy188I	TCNGA	1 cut(s)	178
Hsp92II	CATG	1 cut(s)	151
Ksp22I	TGATCA	1 cut(s)	15
Kzo9I	GATC	4 cut(s)	15, 48, 143, 173
LpnPI	CCDG	1 cut(s)	22
MaeI	CTAG	1 cut(s)	126
MaeIII	GTNAC	2 cut(s)	42, 121
MalI	GATC	4 cut(s)	17, 50, 145, 175
MboI	GATC	4 cut(s)	15, 48, 143, 173
MflI	RGATCY	1 cut(s)	143
MmeI	TCCRAC	1 cut(s)	162
MseI	TTAA	2 cut(s)	21, 104
NcoI	CCATGG	1 cut(s)	147
NdeII	GATC	4 cut(s)	15, 48, 143, 173
NlaIII	CATG	1 cut(s)	151
PfeI	GAWTC	1 cut(s)	132
PspPI	GGNCC	1 cut(s)	75
PsuI	RGATCY	1 cut(s)	143
SaqAI	TTAA	2 cut(s)	21, 104
Sau3AI	GATC	4 cut(s)	15, 48, 143, 173
Sau96I	GGNCC	1 cut(s)	75
SgeI	CNNG	3 cut(s)	49, 138, 160
SspMI	CTAG	1 cut(s)	126
StyI	CCWWGG	1 cut(s)	147
TaqI	TCGA	1 cut(s)	51
TfiI	GAWTC	1 cut(s)	132
Tru1I	TTAA	2 cut(s)	21, 104
Tru9I	TTAA	2 cut(s)	21, 104
TspDTI	ATGAA	2 cut(s)	124, 126
XcmI	CCANNNNNNNNNTGG	1 cut(s)	154
XspI	CTAG	1 cut(s)	126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.