Rh4DG157500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
31453878 .. 31454355
478 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG157500.1

Sequence Viewer

Length: 183 bp
ATGCCAGAGACTTGTGGAGATTCGGTTATGGCAGTTTTGAAGGGTTCGGGTGTAAAGAGATTTAAGAATGACATACCCAGTGCTAGAAGTTGCAAAGCACTAGACATTATCTACCACCTTGTGGAGTTCACAGTGAAGAATGTTATGAAGACGAAGTTTGCTGACTTCCATGTCTTCGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.75

Weight (kDa)

8.69

Isoelectric Point (pI)

39.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000269)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29141 FvH4_1g29142 FvH4_2g04882 FvH4_2g04883 FvH4_2g07612 FvH4_3g26550 FvH4_3g26551 FvH4_3g31781 FvH4_3g31810 FvH4_3g31812 FvH4_4g08580 FvH4_4g08581 FvH4_4g08649 FvH4_4g08910 FvH4_4g10124 FvH4_4g10125 FvH4_4g28760 FvH4_5g16042 FvH4_5g24070 FvH4_5g30680 FvH4_5g37871 FvH4_5g37872 FvH4_7g03531 FvH4_7g12891 FvH4_7g12892 FvH4_7g12893
rosa_chinensis RchiOBHm_Chr7g0204351
rosa_laevigata RLG00000001882 RLG00000002339 RLG00000004189 RLG00000009211 RLG00000009212 RLG00000013650 RLG00000019919 RLG00000019920 RLG00000019921 RLG00000020177 RLG00000020178 RLG00000023368 RLG00000028208 RLG00000029086 RLG00000029688 RLG00000032551 RLG00000034335 RLG00000034807
rosa_multiflora Rmu_sc0000308.1_g000017 Rmu_sc0000308.1_g000018 Rmu_sc0003422.1_g000004 Rmu_sc0003776.1_g000026 Rmu_sc0005399.1_g000010 Rmu_sc0005399.1_g000012 Rmu_sc0009924.1_g000004
rosa_roxburghii Rroxscaffold_1G00053720 Rroxscaffold_1G00053730 Rroxscaffold_1G00054020 Rroxscaffold_2G00133470 Rroxscaffold_2G00133480 Rroxscaffold_3G00229920 Rroxscaffold_3G00229930 Rroxscaffold_3G00229940 Rroxscaffold_3G00245890 Rroxscaffold_3G00245900 Rroxscaffold_4G00317860 Rroxscaffold_5G00346620 Rroxscaffold_6G00396640 Rroxscaffold_6G00396930 Rroxscaffold_6G00396940 Rroxscaffold_6G00401510 Rroxscaffold_7G00201920 Rroxscaffold_7G00201930 Rroxscaffold_7G00201940
rosa_rugosa Rorug01G0116700 Rorug01G0116700 Rorug04G0072900 Rorug04G0073000 Rorug04G0112000 Rorug07G0258800
rosa_samantha Rh1AG123800 Rh1AG297000 Rh1DG057400 Rh1DG057500 Rh1DG129000 Rh2BG298000 Rh2BG471200 Rh2BG471300 Rh2BG471400 Rh2BG621400 Rh3CG245500 Rh3CG245600 Rh4DG157200 Rh4DG157300 Rh4DG157400 Rh4DG157500 Rh4DG157600 Rh4DG157700 Rh5DG402200 Rh6AG050900 Rh6AG051000 Rh6AG088400 Rh6AG088500 Rh6AG088600 Rh6AG088700 Rh6AG139800 Rh6AG139900 Rh6AG140000 Rh6CG077200 Rh6CG077300 Rh6CG077400 Rh6CG077500 Rh7CG225300 Rh7CG225400 Rh7CG225500 Rh7CG225600 Rh7CG267500 Rh7CG267600 Rh7CG267800 Rh7CG267900 Rh7CG338700 Rh7CG338800 Rh7CG338900 Rh7CG430900 Rh7CG431000 Rh7CG431100 Rh7DG219700 Rh7DG219800 Rh7DG219900 Rh7DG220000 Rh7DG257600 Rh7DG271500 Rh7DG367700 Rh7DG408600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 170
AccB7I CCANNNNNTGG 1 cut(s) 121
AdeI CACNNNGTG 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 40
Alw26I GTCTC 1 cut(s) 2
BbsI GAAGAC 2 cut(s) 155, 166
BcoDI GTCTC 1 cut(s) 2
BfaI CTAG 2 cut(s) 84, 101
BmrI ACTGGG 1 cut(s) 72
BmuI ACTGGG 1 cut(s) 72
BpiI GAAGAC 2 cut(s) 155, 166
BsaXI ACNNNNNCTCC 2 cut(s) 9, 39
Bsc4I CCNNNNNNNGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 78
BseLI CCNNNNNNNGG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 2
BsrI ACTGG 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 133
BstMAI GTCTC 1 cut(s) 2
BstV2I GAAGAC 2 cut(s) 155, 166
BtsIMutI CAGTG 2 cut(s) 85, 138
CviAII CATG 1 cut(s) 170
DraIII CACNNNGTG 1 cut(s) 121
DrdI GACNNNNNNGTC 1 cut(s) 170
DseDI GACNNNNNNGTC 1 cut(s) 170
FaeI CATG 1 cut(s) 173
FaiI YATR 4 cut(s) 29, 74, 146, 171
FatI CATG 1 cut(s) 169
FspBI CTAG 2 cut(s) 84, 101
Hin1II CATG 1 cut(s) 173
HinfI GANTC 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 129
Hpy8I GTNNAC 1 cut(s) 129
HpyAV CCTTC 1 cut(s) 34
HpyCH4III ACNGT 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 93
Hsp92II CATG 1 cut(s) 173
LpnPI CCDG 2 cut(s) 18, 91
MaeI CTAG 2 cut(s) 84, 101
MboII GAAGA 3 cut(s) 148, 160, 166
MseI TTAA 1 cut(s) 63
NlaIII CATG 1 cut(s) 173
PfeI GAWTC 1 cut(s) 20
PflMI CCANNNNNTGG 1 cut(s) 121
SaqAI TTAA 1 cut(s) 63
SetI ASST 1 cut(s) 120
SgeI CNNG 7 cut(s) 17, 24, 60, 90, 96, 113, 131
SspMI CTAG 2 cut(s) 84, 101
TaaI ACNGT 1 cut(s) 133
TaqI TCGA 1 cut(s) 177
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 2 cut(s) 85, 138
TspDTI ATGAA 1 cut(s) 161
TspRI CASTG 2 cut(s) 85, 138
Van91I CCANNNNNTGG 1 cut(s) 121
XspI CTAG 2 cut(s) 84, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.