Rh6CG167300

plant mutator transposase zinc finger

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
22640523 .. 22640837
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG167300.1

Sequence Viewer

Length: 315 bp
ATGAAGAAAACTACTCATTTTCATGTTTCATTCAATGAAGAGAATGATTGTTGCCTCTTTCAGTTTAAAGGTATATTATGCAGGCATGCAATATATGTTCTGATTCGTCATAAGAAAAACATGATTTCAGATAAATATATCATGAGAAGATGGAGGAAGGATGTGAAGAGGTGTCACACAAGGGTTAAAATCAGTTATGACATATGGGATGCTAGACCTCAATCACAAAGACTTGACAAGATGCAAAAGAATTTTGATGACATTAAGGAATTAGCATACGATTCTGAAGATAAGTGCATGATTGTTATGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

12.76

Weight (kDa)

9.4

Isoelectric Point (pI)

53.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000252)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G80010
fragaria_vesca FvH4_2g24400 FvH4_2g24401 FvH4_2g28851 FvH4_2g28851 FvH4_2g28851 FvH4_2g28851 FvH4_3g17011 FvH4_4g07801 FvH4_6g23211 FvH4_6g29411 FvH4_6g29411 FvH4_6g29411 FvH4_6g29432 FvH4_6g29432 FvH4_7g19111
malus_domestica MD05G1027500.v1.1 MD08G1156300.v1.1 MD15G1127000.v1.1 MD17G1214400.v1.1 MD17G1214600.v1.1
prunus_persica Prupe.1G268400_v2.0.a1 Prupe.1G482700_v2.0.a1 Prupe.2G013600_v2.0.a1 Prupe.2G072300_v2.0.a1 Prupe.3G090300_v2.0.a1 Prupe.3G090300_v2.0.a1 Prupe.3G090500_v2.0.a1 Prupe.4G256500_v2.0.a1 Prupe.6G116200_v2.0.a1 Prupe.7G015200_v2.0.a1 Prupe.8G014900_v2.0.a1
pyrus_communis pycom05g24990 pycom12g03510 pycom16g12560 pycom17g21900 pycom17g21920
rosa_chinensis RchiOBHm_Chr2g0134881 RchiOBHm_Chr2g0134921 RchiOBHm_Chr6g0297621
rosa_laevigata RLG00000011576 RLG00000012728 RLG00000013853 RLG00000014630 RLG00000019427 RLG00000019430 RLG00000020625
rosa_multiflora Rmu_sc0001385.1_g000003 Rmu_sc0001541.1_g000005 Rmu_sc0001719.1_g000010 Rmu_sc0001719.1_g000011 Rmu_sc0002283.1_g000033 Rmu_sc0004350.1_g000004 Rmu_sc0004350.1_g000005 Rmu_sc0004406.1_g000014 Rmu_sc0004564.1_g000003 Rmu_sc0005198.1_g000003 Rmu_sc0005198.1_g000004 Rmu_sc0005198.1_g000005 Rmu_sc0023742.1_g000001 Rmu_sc0023743.1_g000001 Rmu_ssc0000291.1_g000011 Rmu_ssc0000291.1_g000012
rosa_roxburghii Rroxscaffold_2G00109640 Rroxscaffold_2G00109680 Rroxscaffold_2G00114370 Rroxscaffold_2G00135950 Rroxscaffold_3G00225840 Rroxscaffold_3G00227000 Rroxscaffold_7G00170310 Rroxscaffold_7G00172860 Rroxscaffold_7G00179400 Rroxscaffold_7G00198760
rosa_rugosa Rorug02G0321200 Rorug06G0274600 Rorug06G0274700 Rorug06G0274800 Rorug06G0274800 Rorug07G0274900 Rorug07G0275000 Rorug07G0340400
rosa_samantha Rh2AG372600 Rh2AG373100 Rh2BG044500 Rh2BG378300 Rh2BG378700 Rh2CG315500 Rh2CG356800 Rh2CG357600 Rh2DG395100 Rh2DG395500 Rh2DG586300 Rh3BG359900 Rh4BG117400 Rh4BG117500 Rh4DG152400 Rh4DG152500 Rh6AG165100 Rh6AG385200 Rh6BG170300 Rh6BG170400 Rh6BG170500 Rh6BG173200 Rh6BG173300 Rh6BG208000 Rh6BG208100 Rh6BG393300 Rh6CG163800 Rh6CG163900 Rh6CG164000 Rh6CG167300 Rh6CG241900 Rh6CG399100 Rh6DG159100 Rh6DG159200 Rh6DG233500 Rh6DG385700 Rh7AG495200 Rh7AG495300 Rh7BG402900 Rh7BG466600 Rh7BG466700 Rh7DG479900
rosa_wichuraiana Rw0G005930 Rw1G039690 Rw2G030340 Rw2G030400 Rw4G013030 Rw4G013040 Rw5G023130 Rw6G014200 Rw6G014280 Rw6G033560 Rw7G041860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 250
AcuI CTGAAG 1 cut(s) 306
AgsI TTSAA 1 cut(s) 34
ApoI RAATTY 1 cut(s) 250
BccI CCATC 1 cut(s) 144
BfaI CTAG 1 cut(s) 213
BmsI GCATC 2 cut(s) 199, 231
BseGI GGATG 2 cut(s) 166, 214
BspHI TCATGA 1 cut(s) 141
Bst6I CTCTTC 2 cut(s) 33, 161
BstC8I GCNNGC 2 cut(s) 83, 87
BstDEI CTNAG 1 cut(s) 312
BstF5I GGATG 2 cut(s) 166, 214
BstNSI RCATGY 1 cut(s) 89
BtsCI GGATG 2 cut(s) 166, 214
Cac8I GCNNGC 2 cut(s) 83, 87
CciI TCATGA 1 cut(s) 141
CviAII CATG 5 cut(s) 23, 86, 121, 142, 298
DdeI CTNAG 1 cut(s) 312
DraI TTTAAA 1 cut(s) 67
Eam1104I CTCTTC 2 cut(s) 33, 161
EarI CTCTTC 2 cut(s) 33, 161
Eco57I CTGAAG 1 cut(s) 306
FaeI CATG 5 cut(s) 26, 89, 124, 145, 301
FatI CATG 5 cut(s) 22, 85, 120, 141, 297
FauNDI CATATG 1 cut(s) 203
FokI GGATG 2 cut(s) 173, 221
FspBI CTAG 1 cut(s) 213
Hin1II CATG 5 cut(s) 26, 89, 124, 145, 301
HinfI GANTC 2 cut(s) 103, 281
Hpy188I TCNGA 3 cut(s) 102, 130, 286
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 151
HpyCH4V TGCA 4 cut(s) 81, 89, 244, 297
HpyF3I CTNAG 1 cut(s) 312
Hsp92II CATG 5 cut(s) 26, 89, 124, 145, 301
LpnPI CCDG 1 cut(s) 67
LweI GCATC 2 cut(s) 199, 231
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 173
MboII GAAGA 5 cut(s) 16, 50, 159, 178, 299
MluCI AATT 2 cut(s) 250, 269
MnlI CCTC 4 cut(s) 65, 147, 162, 228
MseI TTAA 3 cut(s) 66, 186, 264
MslI CAYNNNNRTG 1 cut(s) 21
NdeI CATATG 1 cut(s) 203
NlaIII CATG 5 cut(s) 26, 89, 124, 145, 301
NmuCI GTSAC 1 cut(s) 173
NspI RCATGY 1 cut(s) 89
PaeI GCATGC 1 cut(s) 89
PagI TCATGA 1 cut(s) 141
PfeI GAWTC 2 cut(s) 103, 281
RseI CAYNNNNRTG 1 cut(s) 21
SaqAI TTAA 3 cut(s) 66, 186, 264
SetI ASST 3 cut(s) 73, 173, 220
SfaNI GCATC 2 cut(s) 199, 231
SmiMI CAYNNNNRTG 1 cut(s) 21
SphI GCATGC 1 cut(s) 89
Sse9I AATT 2 cut(s) 250, 269
SspMI CTAG 1 cut(s) 213
TasI AATT 2 cut(s) 250, 269
TfiI GAWTC 2 cut(s) 103, 281
Tru1I TTAA 3 cut(s) 66, 186, 264
Tru9I TTAA 3 cut(s) 66, 186, 264
TseFI GTSAC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 173
TspDTI ATGAA 4 cut(s) 11, 17, 18, 51
XapI RAATTY 1 cut(s) 250
XceI RCATGY 1 cut(s) 89
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.