Rh7AG495300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0000252
Physical Location & Seq
Reverse (-)
69549356 .. 69549514
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG495300.1

Sequence Viewer

Length: 159 bp
ATGGAAAGTGTTGAGAATGAAATGGATACTGCATATGTGGAAGAAAATATGGACAGTGGGGATGAAGTGGAAACTGAGAGAAGTAATGTGGAAATTGATATTGAAACTACTGATGAGAATGAAACAGTGAAAGAAAGGGTAAAAGAGCCAGAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.04

Weight (kDa)

4.05

Isoelectric Point (pI)

54.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000252)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G80010
fragaria_vesca FvH4_2g24400 FvH4_2g24401 FvH4_2g28851 FvH4_2g28851 FvH4_2g28851 FvH4_2g28851 FvH4_3g17011 FvH4_4g07801 FvH4_6g23211 FvH4_6g29411 FvH4_6g29411 FvH4_6g29411 FvH4_6g29432 FvH4_6g29432 FvH4_7g19111
malus_domestica MD05G1027500.v1.1 MD08G1156300.v1.1 MD15G1127000.v1.1 MD17G1214400.v1.1 MD17G1214600.v1.1
prunus_persica Prupe.1G268400_v2.0.a1 Prupe.1G482700_v2.0.a1 Prupe.2G013600_v2.0.a1 Prupe.2G072300_v2.0.a1 Prupe.3G090300_v2.0.a1 Prupe.3G090300_v2.0.a1 Prupe.3G090500_v2.0.a1 Prupe.4G256500_v2.0.a1 Prupe.6G116200_v2.0.a1 Prupe.7G015200_v2.0.a1 Prupe.8G014900_v2.0.a1
pyrus_communis pycom05g24990 pycom12g03510 pycom16g12560 pycom17g21900 pycom17g21920
rosa_chinensis RchiOBHm_Chr2g0134881 RchiOBHm_Chr2g0134921 RchiOBHm_Chr6g0297621
rosa_laevigata RLG00000011576 RLG00000012728 RLG00000013853 RLG00000014630 RLG00000019427 RLG00000019430 RLG00000020625
rosa_multiflora Rmu_sc0001385.1_g000003 Rmu_sc0001541.1_g000005 Rmu_sc0001719.1_g000010 Rmu_sc0001719.1_g000011 Rmu_sc0002283.1_g000033 Rmu_sc0004350.1_g000004 Rmu_sc0004350.1_g000005 Rmu_sc0004406.1_g000014 Rmu_sc0004564.1_g000003 Rmu_sc0005198.1_g000003 Rmu_sc0005198.1_g000004 Rmu_sc0005198.1_g000005 Rmu_sc0023742.1_g000001 Rmu_sc0023743.1_g000001 Rmu_ssc0000291.1_g000011 Rmu_ssc0000291.1_g000012
rosa_roxburghii Rroxscaffold_2G00109640 Rroxscaffold_2G00109680 Rroxscaffold_2G00114370 Rroxscaffold_2G00135950 Rroxscaffold_3G00225840 Rroxscaffold_3G00227000 Rroxscaffold_7G00170310 Rroxscaffold_7G00172860 Rroxscaffold_7G00179400 Rroxscaffold_7G00198760
rosa_rugosa Rorug02G0321200 Rorug06G0274600 Rorug06G0274700 Rorug06G0274800 Rorug06G0274800 Rorug07G0274900 Rorug07G0275000 Rorug07G0340400
rosa_samantha Rh2AG372600 Rh2AG373100 Rh2BG044500 Rh2BG378300 Rh2BG378700 Rh2CG315500 Rh2CG356800 Rh2CG357600 Rh2DG395100 Rh2DG395500 Rh2DG586300 Rh3BG359900 Rh4BG117400 Rh4BG117500 Rh4DG152400 Rh4DG152500 Rh6AG165100 Rh6AG385200 Rh6BG170300 Rh6BG170400 Rh6BG170500 Rh6BG173200 Rh6BG173300 Rh6BG208000 Rh6BG208100 Rh6BG393300 Rh6CG163800 Rh6CG163900 Rh6CG164000 Rh6CG167300 Rh6CG241900 Rh6CG399100 Rh6DG159100 Rh6DG159200 Rh6DG233500 Rh6DG385700 Rh7AG495200 Rh7AG495300 Rh7BG402900 Rh7BG466600 Rh7BG466700 Rh7DG479900
rosa_wichuraiana Rw0G005930 Rw1G039690 Rw2G030340 Rw2G030400 Rw4G013030 Rw4G013040 Rw5G023130 Rw6G014200 Rw6G014280 Rw6G033560 Rw7G041860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 104
BciVI GTATCC 1 cut(s) 19
BfuI GTATCC 1 cut(s) 19
BseGI GGATG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 67
Bst4CI ACNGT 2 cut(s) 56, 127
BstDEI CTNAG 1 cut(s) 75
BstF5I GGATG 1 cut(s) 67
BsuI GTATCC 1 cut(s) 19
BtsCI GGATG 1 cut(s) 67
BtsIMutI CAGTG 2 cut(s) 61, 132
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
DdeI CTNAG 1 cut(s) 75
FaiI YATR 3 cut(s) 34, 36, 50
FauNDI CATATG 1 cut(s) 34
FokI GGATG 1 cut(s) 74
HpyCH4III ACNGT 2 cut(s) 56, 127
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 75
MboII GAAGA 1 cut(s) 53
MluCI AATT 1 cut(s) 93
NdeI CATATG 1 cut(s) 34
Sse9I AATT 1 cut(s) 93
TaaI ACNGT 2 cut(s) 56, 127
TasI AATT 1 cut(s) 93
TscAI CASTG 2 cut(s) 61, 132
TspDTI ATGAA 3 cut(s) 33, 78, 135
TspRI CASTG 2 cut(s) 61, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.