Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004940.1

Orthogroup ID

OG0000185

Physical Location & Seq

Genomic Coordinates Forward (+)

84116 .. 84921

Gene Structure 806 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004940.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 417 bp

atgtacaagcatgtttggaaacttgaaaaattttcaaagttgaacgctcagttctaccactcaaaacaattcagtgcagaaggactaaactgggctatagtactctatcccaagaggaaaagcaccacaaacgatccttctcatctgtctgtttacttgcaatgggttgctgaaaaaacaagtcatgtcaccaaagtatttacagagtatgccttacgcattgtagatcgaaatcatgccagcattcaatatcgctcagttaagtactgttttaacactgcctctcggactcatggttggcctgaattcatttcacttggtgatttaagtggtcttttgaagtacgatacttgcctagtggaggcagaggtcactgttcgtgcaattgctaagattcttgctaaagatgcatgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0004843 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006508 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0008233 GO:0008234 GO:0009719 GO:0009725 GO:0009753 GO:0009755 GO:0009867 GO:0009987 GO:0010033 GO:0016787 GO:0019538 GO:0019783 GO:0023052 GO:0032870 GO:0036459 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0070011 GO:0070887 GO:0071229 GO:0071310 GO:0071395 GO:0071495 GO:0071704 GO:0101005 GO:0140096 GO:1901564 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

ko04340 ko04341 map04340 map04341

Pfam Domains

Protein Families

MATH

Protein Analysis

138

Amino Acids

15.95

Weight (kDa)

9.36

Isoelectric Point (pI)

26.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000185)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G17380
fragaria_vesca	FvH4_4g21140 FvH4_4g21140 FvH4_4g21190 FvH4_4g21293 FvH4_4g21321 FvH4_4g21321 FvH4_4g21321 FvH4_4g21850 FvH4_6g51410 FvH4_7g09650
malus_domestica	MD07G1100800.v1.1 MD13G1142200.v1.1 MD13G1142800.v1.1 MD13G1142900.v1.1 MD13G1143000.v1.1 MD13G1143200.v1.1 MD13G1143500.v1.1 MD13G1144900.v1.1 MD13G1145100.v1.1 MD13G1145600.v1.1 MD16G1132700.v1.1 MD16G1132900.v1.1 MD16G1138600.v1.1 MD16G1138800.v1.1 MD16G1146500.v1.1
prunus_persica	Prupe.1G107200_v2.0.a1 Prupe.1G107200_v2.0.a1 Prupe.1G107400_v2.0.a1 Prupe.1G107500_v2.0.a1 Prupe.1G107700_v2.0.a1 Prupe.1G107800_v2.0.a1 Prupe.1G107900_v2.0.a1 Prupe.1G108000_v2.0.a1 Prupe.2G123800_v2.0.a1 Prupe.7G081500_v2.0.a1 Prupe.7G081600_v2.0.a1 Prupe.7G081700_v2.0.a1
pyrus_communis	pycom13g12350 pycom13g12370 pycom13g12380 pycom13g12390 pycom13g12400 pycom13g12440 pycom16g12300
rosa_chinensis	RchiOBHm_Chr1g0346551 RchiOBHm_Chr1g0378981 RchiOBHm_Chr4g0402791 RchiOBHm_Chr4g0410831 RchiOBHm_Chr4g0426731 RchiOBHm_Chr4g0426761 RchiOBHm_Chr4g0426771 RchiOBHm_Chr4g0426801 RchiOBHm_Chr4g0426981 RchiOBHm_Chr4g0427031 RchiOBHm_Chr4g0427041 RchiOBHm_Chr4g0427051 RchiOBHm_Chr4g0427071 RchiOBHm_Chr4g0427081 RchiOBHm_Chr4g0428091 RchiOBHm_Chr4g0428111 RchiOBHm_Chr5g0048271
rosa_laevigata	RLG00000007181 RLG00000007182 RLG00000007233 RLG00000007236 RLG00000007239 RLG00000007263 RLG00000007264 RLG00000007265 RLG00000007269 RLG00000007277 RLG00000007278 RLG00000007279 RLG00000007282 RLG00000028794
rosa_multiflora	Rmu_co8499169.1_g000001 Rmu_sc0000953.1_g000004 Rmu_sc0000953.1_g000009 Rmu_sc0000953.1_g000010 Rmu_sc0000953.1_g000016 Rmu_sc0000953.1_g000021 Rmu_sc0000953.1_g000028 Rmu_sc0000953.1_g000029 Rmu_sc0001734.1_g000009 Rmu_sc0002091.1_g000024 Rmu_sc0004940.1_g000016 Rmu_sc0009599.1_g000017 Rmu_sc0010934.1_g000001 Rmu_sc0013367.1_g000001
rosa_roxburghii	Rroxscaffold_4G00308240 Rroxscaffold_5G00368720 Rroxscaffold_5G00368730 Rroxscaffold_5G00368760 Rroxscaffold_5G00368770 Rroxscaffold_5G00368870 Rroxscaffold_5G00368900 Rroxscaffold_5G00368910 Rroxscaffold_5G00369810 Rroxscaffold_5G00369820
rosa_rugosa	Rorug01G0181000 Rorug04G0208500 Rorug04G0214500 Rorug04G0214700 Rorug04G0214800 Rorug04G0214900 Rorug04G0215400 Rorug04G0215600 Rorug04G0215700 Rorug04G0215800 Rorug04G0218400 Rorug04G0222200 Rorug04G0222300
rosa_samantha	Rh1AG200200 Rh1BG166500 Rh1CG185200 Rh1DG197300 Rh4AG264300 Rh4AG269500 Rh4AG269800 Rh4AG269900 Rh4AG270800 Rh4AG271300 Rh4AG271400 Rh4AG271600 Rh4AG279600 Rh4BG275800 Rh4BG276100 Rh4BG276200 Rh4BG277100 Rh4BG277400 Rh4BG277500 Rh4BG285000 Rh4CG290400 Rh4CG290700 Rh4CG290800 Rh4CG290900 Rh4CG291800 Rh4CG292100 Rh4CG292200 Rh4DG272800 Rh4DG273100 Rh4DG273200 Rh4DG273400 Rh4DG274300 Rh4DG274900 Rh4DG275000 Rh4DG282100 Rh7AG411500
rosa_wichuraiana	Rw0G012470 Rw1G016770 Rw2G005260 Rw4G023380 Rw4G023410 Rw4G023420 Rw4G023510 Rw4G023530 Rw4G023540 Rw4G023550 Rw4G023560 Rw4G024290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	128
AcsI	RAATTY	2 cut(s)	29, 305
AdeI	CACNNNGTG	1 cut(s)	320
AfaI	GTAC	4 cut(s)	5, 102, 266, 344
AfiI	CCNNNNNNNGG	1 cut(s)	361
AgsI	TTSAA	5 cut(s)	26, 36, 43, 248, 340
AlwI	GGATC	1 cut(s)	128
AoxI	GGCC	1 cut(s)	299
ApoI	RAATTY	2 cut(s)	29, 305
AsuHPI	GGTGA	2 cut(s)	181, 332
BfaI	CTAG	1 cut(s)	356
BfmI	CTRYAG	1 cut(s)	96
BmcAI	AGTACT	2 cut(s)	102, 266
BmrI	ACTGGG	1 cut(s)	100
BmsI	GCATC	1 cut(s)	397
BmuI	ACTGGG	1 cut(s)	100
BsaBI	GATNNNNATC	1 cut(s)	231
Bsc4I	CCNNNNNNNGG	1 cut(s)	361
Bse1I	ACTGG	1 cut(s)	95
Bse3DI	GCAATG	1 cut(s)	167
Bse8I	GATNNNNATC	1 cut(s)	231
BseJI	GATNNNNATC	1 cut(s)	231
BseLI	CCNNNNNNNGG	1 cut(s)	361
BseMI	GCAATG	1 cut(s)	167
BseMII	CTCAG	2 cut(s)	62, 270
BseNI	ACTGG	1 cut(s)	95
BsgI	GTGCAG	1 cut(s)	96
BshFI	GGCC	1 cut(s)	301
BslI	CCNNNNNNNGG	1 cut(s)	361
BsmI	GAATGC	1 cut(s)	243
BsnI	GGCC	1 cut(s)	301
Bsp1407I	TGTACA	1 cut(s)	3
Bsp143I	GATC	2 cut(s)	133, 226
BspANI	GGCC	1 cut(s)	301
BspCNI	CTCAG	2 cut(s)	61, 269
BspPI	GGATC	1 cut(s)	128
BsrDI	GCAATG	1 cut(s)	167
BsrGI	TGTACA	1 cut(s)	3
BsrI	ACTGG	1 cut(s)	95
BssMI	GATC	2 cut(s)	133, 226
Bst4CI	ACNGT	2 cut(s)	269, 376
BstAUI	TGTACA	1 cut(s)	3
BstC8I	GCNNGC	2 cut(s)	241, 412
BstDEI	CTNAG	3 cut(s)	48, 256, 390
BstENI	CCTNNNNNAGG	1 cut(s)	359
BstKTI	GATC	2 cut(s)	136, 229
BstMBI	GATC	2 cut(s)	133, 226
BstMWI	GCNNNNNNNGC	1 cut(s)	407
BstNSI	RCATGY	2 cut(s)	14, 414
BstSFI	CTRYAG	1 cut(s)	96
BsuRI	GGCC	1 cut(s)	301
BtsI	GCAGTG	1 cut(s)	276
BtsIMutI	CAGTG	3 cut(s)	79, 276, 372
Cac8I	GCNNGC	2 cut(s)	241, 412
Csp6I	GTAC	4 cut(s)	4, 101, 265, 343
CviAII	CATG	5 cut(s)	11, 185, 236, 293, 411
CviJI	RGCY	2 cut(s)	95, 301
CviKI_1	RGCY	2 cut(s)	95, 301
CviQI	GTAC	4 cut(s)	4, 101, 265, 343
DdeI	CTNAG	3 cut(s)	48, 256, 390
DpnI	GATC	2 cut(s)	135, 228
DpnII	GATC	2 cut(s)	133, 226
DraIII	CACNNNGTG	1 cut(s)	320
EcoNI	CCTNNNNNAGG	1 cut(s)	359
EcoRI	GAATTC	1 cut(s)	305
EcoT22I	ATGCAT	1 cut(s)	412
FaeI	CATG	5 cut(s)	14, 188, 239, 296, 414
FaiI	YATR	7 cut(s)	12, 98, 186, 210, 237, 294, 412
FatI	CATG	5 cut(s)	10, 184, 235, 292, 410
FspBI	CTAG	1 cut(s)	356
HaeIII	GGCC	1 cut(s)	301
Hin1II	CATG	5 cut(s)	14, 188, 239, 296, 414
HinfI	GANTC	2 cut(s)	289, 394
HphI	GGTGA	2 cut(s)	181, 332
Hpy166II	GTNNAC	1 cut(s)	154
Hpy188I	TCNGA	1 cut(s)	288
Hpy8I	GTNNAC	1 cut(s)	154
HpyAV	CCTTC	2 cut(s)	74, 147
HpyCH4III	ACNGT	2 cut(s)	269, 376
HpyCH4V	TGCA	4 cut(s)	77, 160, 383, 410
HpyF10VI	GCNNNNNNNGC	1 cut(s)	407
HpyF3I	CTNAG	3 cut(s)	48, 256, 390
Hsp92II	CATG	5 cut(s)	14, 188, 239, 296, 414
Kzo9I	GATC	2 cut(s)	133, 226
LpnPI	CCDG	3 cut(s)	76, 253, 315
LweI	GCATC	1 cut(s)	397
MaeI	CTAG	1 cut(s)	356
MaeIII	GTNAC	2 cut(s)	187, 370
MalI	GATC	2 cut(s)	135, 228
MboI	GATC	2 cut(s)	133, 226
MfeI	CAATTG	1 cut(s)	384
MluCI	AATT	4 cut(s)	29, 68, 305, 384
MlyI	GAGTC	1 cut(s)	283
MnlI	CCTC	4 cut(s)	108, 292, 355, 361
Mph1103I	ATGCAT	1 cut(s)	412
MseI	TTAA	3 cut(s)	261, 273, 326
MunI	CAATTG	1 cut(s)	384
Mva1269I	GAATGC	1 cut(s)	243
MwoI	GCNNNNNNNGC	1 cut(s)	407
NdeII	GATC	2 cut(s)	133, 226
NlaIII	CATG	5 cut(s)	14, 188, 239, 296, 414
NmuCI	GTSAC	2 cut(s)	187, 370
NsiI	ATGCAT	1 cut(s)	412
NspI	RCATGY	2 cut(s)	14, 414
PaeI	GCATGC	1 cut(s)	414
PctI	GAATGC	1 cut(s)	243
PfeI	GAWTC	1 cut(s)	394
PleI	GAGTC	1 cut(s)	283
PpsI	GAGTC	1 cut(s)	283
RsaI	GTAC	4 cut(s)	5, 102, 266, 344
RsaNI	GTAC	4 cut(s)	4, 101, 265, 343
SaqAI	TTAA	3 cut(s)	261, 273, 326
Sau3AI	GATC	2 cut(s)	133, 226
ScaI	AGTACT	2 cut(s)	102, 266
SchI	GAGTC	1 cut(s)	283
SetI	ASST	1 cut(s)	372
SfaNI	GCATC	1 cut(s)	397
SfcI	CTRYAG	1 cut(s)	96
SphI	GCATGC	1 cut(s)	414
Sse9I	AATT	4 cut(s)	29, 68, 305, 384
SspMI	CTAG	1 cut(s)	356
TaaI	ACNGT	2 cut(s)	269, 376
TaqI	TCGA	1 cut(s)	229
TasI	AATT	4 cut(s)	29, 68, 305, 384
TatI	WGTACW	3 cut(s)	3, 100, 264
TfiI	GAWTC	1 cut(s)	394
Tru1I	TTAA	3 cut(s)	261, 273, 326
Tru9I	TTAA	3 cut(s)	261, 273, 326
TscAI	CASTG	3 cut(s)	79, 283, 379
TseFI	GTSAC	2 cut(s)	187, 370
Tsp45I	GTSAC	2 cut(s)	187, 370
TspDTI	ATGAA	1 cut(s)	298
TspRI	CASTG	3 cut(s)	79, 283, 379
XagI	CCTNNNNNAGG	1 cut(s)	359
XapI	RAATTY	2 cut(s)	29, 305
XceI	RCATGY	2 cut(s)	14, 414
XspI	CTAG	1 cut(s)	356
ZrmI	AGTACT	2 cut(s)	102, 266
Zsp2I	ATGCAT	1 cut(s)	412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.