RLG00000008530

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0000268
Physical Location & Seq
Forward (+)
31714393 .. 31715894
1502 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008530

Sequence Viewer

Length: 690 bp
ATGGAGGATAAGCCAAGAAAGCTGCAAGATATTGGTCCTTTCACAGGGTGTCGTGATCTTTATGATGACGACGTATATTTGATCGCTTTCAGAATTTTTCAAACAGATTATGAACATCTTGACCGTTTGGCAATGAAATGCCTAGAGCCAGGGGGACTTGTTACCTCCGAGATATTTATCCCCATCCTGGATCCAGATACTACCCCAAACCACTGGTTCTTCATTGTGATTAAATTAGCGAGAACGGATGTAGAGATATGGGACACTTACCCTAACCCTGCACGCACTATGGCTCGAAATCATCTTGTTTATTATGTGCTTTTGGCATTGGACACAATATTTGACACTGAAATCCAAAGCTGTTTCAAGAAAGGATGGTCGTTATGTTCATTCACAGTTTTCAATTTAGATTCCGTAAATCGTCGTGTGCAACTTGCCCTTTGGATGTTGAAGCACCCAAAGAACCAAGCATGGGTGAAAATTAATGAGGCTTTAGATAATGAAAACAAAAATGATGGTGCCAAGAACAAGATCAAGACAATAGAAGAAATTGACGAAGCTACTGGAAATAGTGTTGATCAACATCATGGCAAGACCTGTTCACAAGTCGTGCAGAGAAAAACCTCAACACTACAAGCAAGGGGTCGTGGTCGCCCTCGTGGTGCAAAGAATAAAAACTCTCATAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

230

Amino Acids

26.42

Weight (kDa)

8.22

Isoelectric Point (pI)

30.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000268)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g23642 FvH4_2g09911 FvH4_2g09911 FvH4_2g09911 FvH4_3g18421 FvH4_4g05321 FvH4_6g28332 FvH4_7g31231
prunus_persica Prupe.2G063700_v2.0.a1 Prupe.5G238300_v2.0.a1 Prupe.6G153700_v2.0.a1 Prupe.7G017400_v2.0.a1 Prupe.7G070100_v2.0.a1 Prupe.7G070100_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0345471 RchiOBHm_Chr1g0366901 RchiOBHm_Chr2g0162601 RchiOBHm_Chr6g0266661 RchiOBHm_Chr6g0266671
rosa_laevigata RLG00000005047 RLG00000007971 RLG00000008530 RLG00000009009 RLG00000009046 RLG00000014086 RLG00000017162 RLG00000017163 RLG00000017440 RLG00000019098 RLG00000022623 RLG00000024566 RLG00000027733 RLG00000029878 RLG00000029945 RLG00000030127 RLG00000030157 RLG00000031078 RLG00000031080 RLG00000034338 RLG00000034670
rosa_multiflora Rmu_sc0002106.1_g000007 Rmu_sc0002531.1_g000064 Rmu_sc0003433.1_g000005 Rmu_sc0004704.1_g000001 Rmu_sc0004704.1_g000002 Rmu_sc0004888.1_g000042 Rmu_sc0005599.1_g000031 Rmu_sc0006413.1_g000014 Rmu_sc0006413.1_g000018
rosa_roxburghii Rroxscaffold_1G00031940 Rroxscaffold_1G00032500 Rroxscaffold_1G00074770 Rroxscaffold_1G00074780 Rroxscaffold_1G00075150 Rroxscaffold_2G00125060 Rroxscaffold_2G00125070 Rroxscaffold_2G00125800 Rroxscaffold_2G00125820 Rroxscaffold_2G00139560 Rroxscaffold_2G00140550 Rroxscaffold_4G00314090 Rroxscaffold_6G00390050 Rroxscaffold_6G00390520 Rroxscaffold_6G00390530 Rroxscaffold_6G00428030 Rroxscaffold_7G00201570 Rroxscaffold_7G00201580 Rroxscaffold_7G00207070 Rroxscaffold_7G00207080 Rroxscaffold_7G00207240
rosa_rugosa Rorug01G0408000 Rorug01G0408100 Rorug01G0408100 Rorug01G0408200 Rorug02G0155200 Rorug02G0181500 Rorug02G0288400 Rorug03G0208600 Rorug03G0272300 Rorug06G0005500 Rorug06G0005600 Rorug06G0026300.1 Rorug06G0026400 Rorug06G0026500 Rorug06G0026600 Rorug06G0026600 Rorug06G0026600 Rorug06G0145800 Rorug07G0305200
rosa_samantha Rh1AG062100 Rh1BG131900 Rh1BG157000 Rh1CG021100 Rh1CG321600 Rh1DG188200 Rh2DG388300 Rh3AG320500 Rh3BG355400 Rh3CG352400 Rh3CG353200 Rh4AG045800 Rh4DG171700 Rh5AG196000 Rh5AG196100 Rh5CG346800 Rh6BG147600 Rh6BG147700 Rh6CG143200 Rh6CG143500 Rh6CG174600 Rh6CG391800 Rh6DG132100 Rh6DG132300 Rh6DG167100 Rh6DG167200 Rh7AG211600 Rh7BG307000 Rh7BG307300 Rh7BG398300
rosa_wichuraiana Rw0G001830 Rw0G001840 Rw0G018160 Rw0G018170 Rw3G028040 Rw5G017860 Rw5G026710 Rw6G012630 Rw6G012650 Rw6G012780 Rw6G012800 Rw7G019130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 518
AclWI GGATC 2 cut(s) 185, 198
AcsI RAATTY 1 cut(s) 93
AdeI CACNNNGTG 1 cut(s) 48
AfiI CCNNNNNNNGG 3 cut(s) 44, 187, 472
AgsI TTSAA 4 cut(s) 101, 367, 403, 451
AjnI CCWGG 2 cut(s) 148, 186
AluBI AGCT 3 cut(s) 22, 360, 560
AluI AGCT 3 cut(s) 22, 360, 560
AlwI GGATC 2 cut(s) 185, 198
ApeKI GCWGC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 93
ArsI GACNNNNNNTTYG 2 cut(s) 323, 355
AseI ATTAAT 1 cut(s) 483
AspS9I GGNCC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 487
AvaII GGWCC 1 cut(s) 35
BamHI GGATCC 1 cut(s) 190
BanI GGYRCC 1 cut(s) 518
BauI CACGAG 1 cut(s) 657
BbvI GCAGC 1 cut(s) 9
BccI CCATC 3 cut(s) 191, 369, 509
BciT130I CCWGG 2 cut(s) 150, 188
BclI TGATCA 1 cut(s) 577
BfaI CTAG 1 cut(s) 143
BisI GCNGC 1 cut(s) 23
BlsI GCNGC 1 cut(s) 24
Bme1390I CCNGG 2 cut(s) 150, 188
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmiI GGNNCC 2 cut(s) 192, 520
BmrFI CCNGG 2 cut(s) 150, 188
BsaBI GATNNNNATC 2 cut(s) 176, 582
BsaJI CCNNGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 3 cut(s) 44, 187, 472
Bse1I ACTGG 2 cut(s) 218, 568
Bse3DI GCAATG 1 cut(s) 138
Bse8I GATNNNNATC 2 cut(s) 176, 582
BseBI CCWGG 2 cut(s) 150, 188
BseDI CCNNGG 1 cut(s) 149
BseGI GGATG 4 cut(s) 183, 253, 380, 450
BseJI GATNNNNATC 2 cut(s) 176, 582
BseLI CCNNNNNNNGG 3 cut(s) 44, 187, 472
BseMI GCAATG 1 cut(s) 138
BseNI ACTGG 2 cut(s) 218, 568
BseXI GCAGC 1 cut(s) 9
BsgI GTGCAG 2 cut(s) 264, 632
BshNI GGYRCC 1 cut(s) 518
BslFI GGGAC 2 cut(s) 168, 275
BslI CCNNNNNNNGG 3 cut(s) 44, 187, 472
BsmFI GGGAC 2 cut(s) 168, 275
Bsp143I GATC 5 cut(s) 55, 81, 190, 531, 577
BspLI GGNNCC 2 cut(s) 192, 520
BspPI GGATC 2 cut(s) 185, 198
BspT107I GGYRCC 1 cut(s) 518
BsrDI GCAATG 1 cut(s) 138
BsrI ACTGG 2 cut(s) 218, 568
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 5 cut(s) 55, 81, 190, 531, 577
BssSI CACGAG 1 cut(s) 657
Bst2BI CACGAG 1 cut(s) 657
Bst2UI CCWGG 2 cut(s) 150, 188
Bst4CI ACNGT 2 cut(s) 125, 397
BstC8I GCNNGC 1 cut(s) 283
BstENI CCTNNNNNAGG 1 cut(s) 42
BstF5I GGATG 4 cut(s) 183, 253, 380, 450
BstKTI GATC 5 cut(s) 58, 84, 193, 534, 580
BstMBI GATC 5 cut(s) 55, 81, 190, 531, 577
BstMWI GCNNNNNNNGC 1 cut(s) 19
BstNI CCWGG 2 cut(s) 150, 188
BstSCI CCNGG 2 cut(s) 148, 186
BstV1I GCAGC 1 cut(s) 9
BstX2I RGATCY 1 cut(s) 190
BstXI CCANNNNNNTGG 1 cut(s) 213
BstYI RGATCY 1 cut(s) 190
BtsCI GGATG 4 cut(s) 183, 253, 380, 450
BtsIMutI CAGTG 2 cut(s) 211, 345
Cac8I GCNNGC 1 cut(s) 283
Cfr13I GGNCC 1 cut(s) 35
CviAII CATG 2 cut(s) 471, 587
CviJI RGCY 7 cut(s) 13, 22, 148, 293, 360, 491, 560
CviKI_1 RGCY 7 cut(s) 13, 22, 148, 293, 360, 491, 560
DpnI GATC 5 cut(s) 57, 83, 192, 533, 579
DpnII GATC 5 cut(s) 55, 81, 190, 531, 577
DraIII CACNNNGTG 1 cut(s) 48
Eco47I GGWCC 1 cut(s) 35
EcoNI CCTNNNNNAGG 1 cut(s) 42
EcoRII CCWGG 2 cut(s) 148, 186
FaeI CATG 2 cut(s) 474, 590
FaqI GGGAC 2 cut(s) 168, 275
FatI CATG 2 cut(s) 470, 586
FbaI TGATCA 1 cut(s) 577
Fnu4HI GCNGC 1 cut(s) 23
FokI GGATG 4 cut(s) 170, 260, 387, 457
Fsp4HI GCNGC 1 cut(s) 23
FspBI CTAG 1 cut(s) 143
GluI GCNGC 1 cut(s) 23
Hin1II CATG 2 cut(s) 474, 590
HinfI GANTC 1 cut(s) 410
HphI GGTGA 1 cut(s) 487
Hpy166II GTNNAC 1 cut(s) 602
Hpy188I TCNGA 2 cut(s) 92, 169
Hpy188III TCNNGA 5 cut(s) 53, 119, 194, 367, 535
Hpy8I GTNNAC 1 cut(s) 602
Hpy99I CGWCG 2 cut(s) 74, 426
HpyCH4III ACNGT 2 cut(s) 125, 397
HpyCH4IV ACGT 1 cut(s) 72
HpyCH4V TGCA 5 cut(s) 25, 281, 430, 613, 665
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpySE526I ACGT 1 cut(s) 72
Hsp92II CATG 2 cut(s) 474, 590
Ksp22I TGATCA 1 cut(s) 577
Kzo9I GATC 5 cut(s) 55, 81, 190, 531, 577
Lsp1109I GCAGC 1 cut(s) 9
MaeI CTAG 1 cut(s) 143
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 160
MalI GATC 5 cut(s) 57, 83, 192, 533, 579
MboI GATC 5 cut(s) 55, 81, 190, 531, 577
MboII GAAGA 2 cut(s) 211, 557
MflI RGATCY 1 cut(s) 190
MluCI AATT 5 cut(s) 93, 233, 403, 480, 549
MnlI CCTC 4 cut(s) 175, 481, 634, 666
MseI TTAA 2 cut(s) 231, 483
MspR9I CCNGG 2 cut(s) 150, 188
MvaI CCWGG 2 cut(s) 150, 188
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 5 cut(s) 55, 81, 190, 531, 577
NlaIII CATG 2 cut(s) 474, 590
NlaIV GGNNCC 2 cut(s) 192, 520
PfeI GAWTC 1 cut(s) 410
PfoI TCCNGGA 1 cut(s) 186
PkrI GCNGC 1 cut(s) 24
PshBI ATTAAT 1 cut(s) 483
Psp6I CCWGG 2 cut(s) 148, 186
PspGI CCWGG 2 cut(s) 148, 186
PspN4I GGNNCC 2 cut(s) 192, 520
PspPI GGNCC 1 cut(s) 35
PsuI RGATCY 1 cut(s) 190
SaqAI TTAA 2 cut(s) 231, 483
SatI GCNGC 1 cut(s) 23
Sau3AI GATC 5 cut(s) 55, 81, 190, 531, 577
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 2 cut(s) 150, 188
SetI ASST 7 cut(s) 24, 75, 167, 362, 562, 599, 626
SinI GGWCC 1 cut(s) 35
Sse9I AATT 5 cut(s) 93, 233, 403, 480, 549
SspI AATATT 1 cut(s) 339
SspMI CTAG 1 cut(s) 143
StyD4I CCNGG 2 cut(s) 148, 186
TaaI ACNGT 2 cut(s) 125, 397
TaiI ACGT 1 cut(s) 75
TaqI TCGA 1 cut(s) 295
TasI AATT 5 cut(s) 93, 233, 403, 480, 549
TfiI GAWTC 1 cut(s) 410
Tru1I TTAA 2 cut(s) 231, 483
Tru9I TTAA 2 cut(s) 231, 483
TscAI CASTG 2 cut(s) 218, 352
TseI GCWGC 1 cut(s) 22
TspDTI ATGAA 5 cut(s) 126, 149, 211, 378, 516
TspGWI ACGGA 2 cut(s) 260, 403
TspRI CASTG 2 cut(s) 218, 352
VpaK11BI GGWCC 1 cut(s) 35
VspI ATTAAT 1 cut(s) 483
XagI CCTNNNNNAGG 1 cut(s) 42
XapI RAATTY 1 cut(s) 93
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.