Rh7BG307300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
29495082 .. 29497713
2632 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG307300.1

Sequence Viewer

Length: 249 bp
ATGTTGGGAGGTCTTCTTAGAGGGATACAAGAAGGATTGTTCAAAGTAGTGAGACAAAATGGTGATCAGGATGTCAATATAAAAAGGGACGAGGCTAATGATACTATTAGGCAAAACCATCAAGAAAGTGATGATTTCAAAACTCAAAGTTCAAAAGAAGTTGAGGTTAATGACGAATCATCATGTCAAATACAAAGTGAGGACAACTCTGAGGCAGCACATCCTAAGTGCCTTCTCCTTTTGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.18

Weight (kDa)

4.61

Isoelectric Point (pI)

52.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000268)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g23642 FvH4_2g09911 FvH4_2g09911 FvH4_2g09911 FvH4_3g18421 FvH4_4g05321 FvH4_6g28332 FvH4_7g31231
prunus_persica Prupe.2G063700_v2.0.a1 Prupe.5G238300_v2.0.a1 Prupe.6G153700_v2.0.a1 Prupe.7G017400_v2.0.a1 Prupe.7G070100_v2.0.a1 Prupe.7G070100_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0345471 RchiOBHm_Chr1g0366901 RchiOBHm_Chr2g0162601 RchiOBHm_Chr6g0266661 RchiOBHm_Chr6g0266671
rosa_laevigata RLG00000005047 RLG00000007971 RLG00000008530 RLG00000009009 RLG00000009046 RLG00000014086 RLG00000017162 RLG00000017163 RLG00000017440 RLG00000019098 RLG00000022623 RLG00000024566 RLG00000027733 RLG00000029878 RLG00000029945 RLG00000030127 RLG00000030157 RLG00000031078 RLG00000031080 RLG00000034338 RLG00000034670
rosa_multiflora Rmu_sc0002106.1_g000007 Rmu_sc0002531.1_g000064 Rmu_sc0003433.1_g000005 Rmu_sc0004704.1_g000001 Rmu_sc0004704.1_g000002 Rmu_sc0004888.1_g000042 Rmu_sc0005599.1_g000031 Rmu_sc0006413.1_g000014 Rmu_sc0006413.1_g000018
rosa_roxburghii Rroxscaffold_1G00031940 Rroxscaffold_1G00032500 Rroxscaffold_1G00074770 Rroxscaffold_1G00074780 Rroxscaffold_1G00075150 Rroxscaffold_2G00125060 Rroxscaffold_2G00125070 Rroxscaffold_2G00125800 Rroxscaffold_2G00125820 Rroxscaffold_2G00139560 Rroxscaffold_2G00140550 Rroxscaffold_4G00314090 Rroxscaffold_6G00390050 Rroxscaffold_6G00390520 Rroxscaffold_6G00390530 Rroxscaffold_6G00428030 Rroxscaffold_7G00201570 Rroxscaffold_7G00201580 Rroxscaffold_7G00207070 Rroxscaffold_7G00207080 Rroxscaffold_7G00207240
rosa_rugosa Rorug01G0408000 Rorug01G0408100 Rorug01G0408100 Rorug01G0408200 Rorug02G0155200 Rorug02G0181500 Rorug02G0288400 Rorug03G0208600 Rorug03G0272300 Rorug06G0005500 Rorug06G0005600 Rorug06G0026300.1 Rorug06G0026400 Rorug06G0026500 Rorug06G0026600 Rorug06G0026600 Rorug06G0026600 Rorug06G0145800 Rorug07G0305200
rosa_samantha Rh1AG062100 Rh1BG131900 Rh1BG157000 Rh1CG021100 Rh1CG321600 Rh1DG188200 Rh2DG388300 Rh3AG320500 Rh3BG355400 Rh3CG352400 Rh3CG353200 Rh4AG045800 Rh4DG171700 Rh5AG196000 Rh5AG196100 Rh5CG346800 Rh6BG147600 Rh6BG147700 Rh6CG143200 Rh6CG143500 Rh6CG174600 Rh6CG391800 Rh6DG132100 Rh6DG132300 Rh6DG167100 Rh6DG167200 Rh7AG211600 Rh7BG307000 Rh7BG307300 Rh7BG398300
rosa_wichuraiana Rw0G001830 Rw0G001840 Rw0G018160 Rw0G018170 Rw3G028040 Rw5G017860 Rw5G026710 Rw6G012630 Rw6G012650 Rw6G012780 Rw6G012800 Rw7G019130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 43, 139, 153
Alw26I GTCTC 1 cut(s) 46
ApeKI GCWGC 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 74
BbsI GAAGAC 1 cut(s) 5
BbvI GCAGC 1 cut(s) 227
BccI CCATC 1 cut(s) 126
BciVI GTATCC 1 cut(s) 18
BclI TGATCA 1 cut(s) 64
BcoDI GTCTC 1 cut(s) 46
BfuI GTATCC 1 cut(s) 18
BisI GCNGC 1 cut(s) 216
BlsI GCNGC 1 cut(s) 217
BpiI GAAGAC 1 cut(s) 5
BplI GAGNNNNNCTC 2 cut(s) 191, 223
BseGI GGATG 2 cut(s) 76, 220
BseMII CTCAG 1 cut(s) 201
BseXI GCAGC 1 cut(s) 227
BslFI GGGAC 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 46
BsmFI GGGAC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 202
BssMI GATC 1 cut(s) 64
BstDEI CTNAG 3 cut(s) 17, 210, 225
BstF5I GGATG 2 cut(s) 76, 220
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 46
BstMBI GATC 1 cut(s) 64
BstV1I GCAGC 1 cut(s) 227
BstV2I GAAGAC 1 cut(s) 5
BsuI GTATCC 1 cut(s) 18
BtsCI GGATG 2 cut(s) 76, 220
CviAII CATG 1 cut(s) 183
CviJI RGCY 2 cut(s) 95, 245
CviKI_1 RGCY 2 cut(s) 95, 245
DdeI CTNAG 3 cut(s) 17, 210, 225
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
FaeI CATG 1 cut(s) 186
FaiI YATR 2 cut(s) 80, 184
FaqI GGGAC 1 cut(s) 101
FatI CATG 1 cut(s) 182
FbaI TGATCA 1 cut(s) 64
Fnu4HI GCNGC 1 cut(s) 216
FokI GGATG 2 cut(s) 83, 207
Fsp4HI GCNGC 1 cut(s) 216
GluI GCNGC 1 cut(s) 216
Hin1II CATG 1 cut(s) 186
HinfI GANTC 1 cut(s) 176
HphI GGTGA 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 2 cut(s) 68, 122
HpyAV CCTTC 2 cut(s) 26, 242
HpyF3I CTNAG 3 cut(s) 17, 210, 225
Hsp92II CATG 1 cut(s) 186
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 53
Lsp1109I GCAGC 1 cut(s) 227
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 5
MnlI CCTC 5 cut(s) 14, 85, 157, 193, 205
MseI TTAA 2 cut(s) 168, 247
NdeII GATC 1 cut(s) 64
NlaIII CATG 1 cut(s) 186
PfeI GAWTC 1 cut(s) 176
PkrI GCNGC 1 cut(s) 217
SaqAI TTAA 2 cut(s) 168, 247
SatI GCNGC 1 cut(s) 216
Sau3AI GATC 1 cut(s) 64
SetI ASST 2 cut(s) 13, 168
SgeI CNNG 5 cut(s) 41, 80, 103, 134, 195
TfiI GAWTC 1 cut(s) 176
Tru1I TTAA 2 cut(s) 168, 247
Tru9I TTAA 2 cut(s) 168, 247
TseI GCWGC 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.