Rmu_sc0000307.1_g000013

B3 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000307.1
Physical Location & Seq
Forward (+)
64720 .. 73267
8548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000307.1_g000013.1.cds

Sequence Viewer

Length: 1392 bp
atgaatgaagaagaccccagaaggctgtgggtctcactcgaagaaagatttggcaacgtccgtgactccttgcttcctgacctagaagtgagatggcataacctccgcttctgtgatttcaagtcagttcttgactataactcggaagcacttcgcattaaatccttaatggaattctgtggtaaagagatcacagatgcaatgttgattgagaagactctctctaccttccctgtctctgcattgatggttgctaagaactatcgaatcgatgtaaatgcaagacggatcacaaggtttcatgagctcattggagctatgaatgtcgctgaaaagcatgacaatatccttgtgaagaactataattcgagatccgtggaaacagaacatattccggaatccaattatagtcgcacctctaagagagggcgccaagagcaaaaccctaatcttaggtatacttctggacattctgatccatataatagctctacttgggaagggcctcctgttgatctcagagacgaaactcttataccacctgagtttaccaagaacttcatttggaatgggagatcacctcgcgaatgtgctcttagaggtcctagtggacaatgttgggctgtggaattggaaagaacagaaaatggcttgttcttccagaatggatggcagtgttttgtgaaggatcaccatttagaacttggggattttttgatcttcagatatgatggtgaatcaaagtttactgtcataatctatgatagaagtgcctgtgagaaagatgtaaaagtagccaagaggagaatgaactgttctgtttgtttgaggaataacggaaatcaagctcgagtaaaaaaagaagttcttgaccttgtaactgaaaacaacaagaatatagacagtaaaggcgaaacagtcgttgctggtgaaaaaggaaatgatgccatgtcgggaaagagacctgctaatggttacttggaagaaacaactgatggatccatcttgttcaaatcggagaattcatgttttcaaagaattttgacgaagcattcaaaatatcacattgggtttccaaaagaactcggtgtagctaaaggtcttatgaatgagaagaccatgaagcttgaagatccaactgggagatcatggcctgttagtctgcgtgcttctaaattttacaaaaaagatggcagattatatgaccgtttagacttgacatcaggttggtcacaaatttgtgaagcgaacaaggtttcacttggggataccattatttttgagcttgtcaagcaaagagtgatgaaaattcatattatcagaatagggagattgagaggcaaaggatgtgctgttagactagttgctcctaatgtcaaaagctcaatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

463

Amino Acids

53.13

Weight (kDa)

9.01

Isoelectric Point (pI)

48.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000210)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G66980
fragaria_vesca FvH4_2g27400 FvH4_2g27400 FvH4_2g27400 FvH4_2g40960 FvH4_2g40960 FvH4_2g40960 FvH4_2g40960 FvH4_2g40960 FvH4_3g19710 FvH4_5g30470 FvH4_6g23740 FvH4_6g23740 FvH4_6g23740 FvH4_6g23740 FvH4_6g23740 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g23440 FvH4_7g23440 FvH4_7g23440
malus_domestica MD03G1230100.v1.1 MD03G1230200.v1.1 MD04G1034500.v1.1 MD04G1034600.v1.1 MD08G1039500.v1.1 MD11G1250800.v1.1 MD11G1251100.v1.1 MD11G1251200.v1.1
prunus_persica Prupe.1G388000_v2.0.a1 Prupe.1G388000_v2.0.a1 Prupe.1G388100_v2.0.a1 Prupe.4G178000_v2.0.a1 Prupe.4G178100_v2.0.a1 Prupe.4G178100_v2.0.a1 Prupe.4G178200_v2.0.a1 Prupe.4G178300_v2.0.a1 Prupe.4G178400_v2.0.a1 Prupe.4G178500_v2.0.a1 Prupe.4G206300_v2.0.a1 Prupe.4G206300_v2.0.a1 Prupe.4G206800_v2.0.a1 Prupe.4G206900_v2.0.a1 Prupe.4G207000_v2.0.a1 Prupe.7G064600_v2.0.a1 Prupe.7G064600_v2.0.a1
pyrus_communis pycom03g17770 pycom04g02860 pycom04g02870 pycom08g03160 pycom11g22190 pycom11g22200 pycom11g22210 pycom11g22220
rosa_chinensis RchiOBHm_Chr1g0318651 RchiOBHm_Chr1g0318881 RchiOBHm_Chr1g0319011 RchiOBHm_Chr1g0356381 RchiOBHm_Chr3g0482191 RchiOBHm_Chr5g0033031 RchiOBHm_Chr5g0033041 RchiOBHm_Chr6g0296251 RchiOBHm_Chr6g0299611 RchiOBHm_Chr7g0208501 RchiOBHm_Chr7g0224941
rosa_laevigata RLG00000001845 RLG00000011405 RLG00000011713 RLG00000023362 RLG00000030508 RLG00000030520 RLG00000033444
rosa_multiflora Rmu_sc0000307.1_g000013 Rmu_sc0000986.1_g000010 Rmu_sc0000986.1_g000011 Rmu_sc0002895.1_g000002 Rmu_sc0003503.1_g000005 Rmu_ssc0000357.1_g000023
rosa_roxburghii Rroxscaffold_1G00046900 Rroxscaffold_1G00046920 Rroxscaffold_1G00046930 Rroxscaffold_1G00046940 Rroxscaffold_1G00047010 Rroxscaffold_1G00047020 Rroxscaffold_1G00047030 Rroxscaffold_1G00059830 Rroxscaffold_3G00234250 Rroxscaffold_4G00299610 Rroxscaffold_4G00321350 Rroxscaffold_4G00328680 Rroxscaffold_4G00329000 Rroxscaffold_6G00399560 Rroxscaffold_6G00399970 Rroxscaffold_7G00168510 Rroxscaffold_7G00171700 Rroxscaffold_7G00178360
rosa_rugosa Rorug01G0022500 Rorug01G0022800 Rorug01G0026400 Rorug03G0195600 Rorug05G0135400 Rorug06G0260100 Rorug06G0260200.1 Rorug06G0291000 Rorug06G0291100 Rorug06G0291100 Rorug07G0227000
rosa_samantha Rh1AG035600 Rh1AG038500 Rh1AG045500 Rh1BG031400 Rh1BG034700 Rh1CG034500 Rh1CG037200 Rh1CG048500 Rh1DG032800 Rh1DG035800 Rh1DG052700 Rh3AG247000 Rh3CG277700 Rh3DG274200 Rh5AG227900 Rh5AG228000 Rh5CG256800 Rh5CG256900 Rh5CG257100 Rh5DG234000 Rh5DG234200 Rh6AG401800 Rh6BG380000 Rh6BG410200 Rh6CG385400 Rh6CG415800 Rh6DG372600 Rh6DG403000 Rh7AG376300 Rh7BG362400 Rh7DG372500
rosa_wichuraiana Rw0G008540 Rw1G002780 Rw1G002970 Rw3G022090 Rw5G020870 Rw6G032430 Rw6G035160 Rw7G031430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 973
AccB1I GGYRCC 1 cut(s) 429
AccI GTMKAC 1 cut(s) 458
AccII CGCG 1 cut(s) 585
AccIII TCCGGA 1 cut(s) 394
AciI CCGC 1 cut(s) 106
AclWI GGATC 7 cut(s) 296, 366, 470, 696, 993, 1006, 1127
AcsI RAATTY 6 cut(s) 173, 1021, 1038, 1175, 1236, 1308
AcuI CTGAAG 1 cut(s) 706
AcyI GRCGYC 1 cut(s) 430
AfiI CCNNNNNNNGG 1 cut(s) 971
AgsI TTSAA 5 cut(s) 121, 1012, 1034, 1056, 1130
AhlI ACTAGT 1 cut(s) 1360
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
AluBI AGCT 8 cut(s) 307, 317, 489, 848, 1094, 1126, 1285, 1383
AluI AGCT 8 cut(s) 307, 317, 489, 848, 1094, 1126, 1285, 1383
Alw21I GWGCWC 2 cut(s) 309, 595
Alw26I GTCTC 4 cut(s) 37, 241, 516, 955
AlwI GGATC 7 cut(s) 296, 366, 470, 696, 993, 1006, 1127
Ama87I CYCGRG 1 cut(s) 849
Aor13HI TCCGGA 1 cut(s) 394
AoxI GGCC 2 cut(s) 503, 1151
ApoI RAATTY 6 cut(s) 173, 1021, 1038, 1175, 1236, 1308
Asp700I GAANNNNTTC 2 cut(s) 150, 390
AspLEI GCGC 1 cut(s) 432
AspS9I GGNCC 2 cut(s) 503, 602
AsuHPI GGTGA 4 cut(s) 570, 683, 746, 941
AvaI CYCGRG 1 cut(s) 849
AvaII GGWCC 1 cut(s) 602
BamHI GGATCC 1 cut(s) 998
BanI GGYRCC 1 cut(s) 429
BanII GRGCYC 1 cut(s) 309
BbsI GAAGAC 3 cut(s) 18, 221, 1121
Bbv12I GWGCWC 2 cut(s) 309, 595
BccI CCATC 7 cut(s) 87, 241, 663, 725, 989, 1010, 1184
BcgI CGANNNNNNTGC 2 cut(s) 260, 294
BciVI GTATCC 1 cut(s) 1261
BcoDI GTCTC 4 cut(s) 37, 241, 516, 955
BcuI ACTAGT 1 cut(s) 1360
BfaI CTAG 4 cut(s) 83, 606, 1361, 1390
BfoI RGCGCY 1 cut(s) 433
BfuAI ACCTGC 1 cut(s) 973
BfuI GTATCC 1 cut(s) 1261
Bme18I GGWCC 1 cut(s) 602
BmeT110I CYCGRG 1 cut(s) 849
BmgT120I GGNCC 2 cut(s) 503, 602
BmiI GGNNCC 2 cut(s) 431, 1000
BmrI ACTGGG 1 cut(s) 1149
BmsI GCATC 2 cut(s) 187, 934
BmuI ACTGGG 1 cut(s) 1149
BpiI GAAGAC 3 cut(s) 18, 221, 1121
BplI GAGNNNNNCTC 2 cut(s) 565, 597
Bsa29I ATCGAT 1 cut(s) 270
BsaHI GRCGYC 1 cut(s) 430
BsaI GGTCTC 2 cut(s) 37, 955
BsaJI CCNNGG 1 cut(s) 375
BsaWI WCCGGW 1 cut(s) 394
Bsc4I CCNNNNNNNGG 1 cut(s) 971
Bse1I ACTGG 1 cut(s) 1144
Bse3DI GCAATG 1 cut(s) 207
BseAI TCCGGA 1 cut(s) 394
BseCI ATCGAT 1 cut(s) 270
BseDI CCNNGG 1 cut(s) 375
BseGI GGATG 2 cut(s) 674, 1352
BseLI CCNNNNNNNGG 1 cut(s) 971
BseMI GCAATG 1 cut(s) 207
BseMII CTCAG 2 cut(s) 532, 534
BseNI ACTGG 1 cut(s) 1144
BseRI GAGGAG 1 cut(s) 817
Bsh1236I CGCG 1 cut(s) 585
BshFI GGCC 2 cut(s) 505, 1153
BshNI GGYRCC 1 cut(s) 429
BshVI ATCGAT 1 cut(s) 270
BsiHKAI GWGCWC 2 cut(s) 309, 595
BsiHKCI CYCGRG 1 cut(s) 849
BsiSI CCGG 1 cut(s) 395
BslI CCNNNNNNNGG 1 cut(s) 971
BsmAI GTCTC 4 cut(s) 37, 241, 516, 955
BsmBI CGTCTC 1 cut(s) 516
BsmI GAATGC 1 cut(s) 1051
BsnI GGCC 2 cut(s) 505, 1153
Bso31I GGTCTC 2 cut(s) 37, 955
BsoBI CYCGRG 1 cut(s) 849
Bsp1286I GDGCHC 2 cut(s) 309, 595
Bsp13I TCCGGA 1 cut(s) 394
Bsp68I TCGCGA 1 cut(s) 585
BspACI CCGC 1 cut(s) 106
BspANI GGCC 2 cut(s) 505, 1153
BspCNI CTCAG 2 cut(s) 531, 535
BspDI ATCGAT 1 cut(s) 270
BspEI TCCGGA 1 cut(s) 394
BspFNI CGCG 1 cut(s) 585
BspHI TCATGA 1 cut(s) 301
BspLI GGNNCC 2 cut(s) 431, 1000
BspMI ACCTGC 1 cut(s) 973
BspPI GGATC 7 cut(s) 296, 366, 470, 696, 993, 1006, 1127
BspT107I GGYRCC 1 cut(s) 429
BspTNI GGTCTC 2 cut(s) 37, 955
BsrDI GCAATG 1 cut(s) 207
BsrI ACTGG 1 cut(s) 1144
BssECI CCNNGG 1 cut(s) 375
BssNAI GTATAC 1 cut(s) 459
BssNI GRCGYC 1 cut(s) 430
Bst1107I GTATAC 1 cut(s) 459
Bst4CI ACNGT 5 cut(s) 751, 815, 905, 919, 1208
BstACI GRCGYC 1 cut(s) 430
BstC8I GCNNGC 1 cut(s) 1167
BstDEI CTNAG 6 cut(s) 255, 420, 452, 518, 543, 596
BstDSI CCRYGG 1 cut(s) 375
BstF5I GGATG 2 cut(s) 674, 1352
BstFNI CGCG 1 cut(s) 585
BstH2I RGCGCY 1 cut(s) 433
BstHHI GCGC 1 cut(s) 432
BstMAI GTCTC 4 cut(s) 37, 241, 516, 955
BstMWI GCNNNNNNNGC 2 cut(s) 436, 1291
BstUI CGCG 1 cut(s) 585
BstV2I GAAGAC 3 cut(s) 18, 221, 1121
BstX2I RGATCY 3 cut(s) 371, 998, 1132
BstYI RGATCY 3 cut(s) 371, 998, 1132
BstZ17I GTATAC 1 cut(s) 459
Bsu15I ATCGAT 1 cut(s) 270
BsuI GTATCC 1 cut(s) 1261
BsuRI GGCC 2 cut(s) 505, 1153
BsuTUI ATCGAT 1 cut(s) 270
BtgI CCRYGG 1 cut(s) 375
BtsCI GGATG 2 cut(s) 674, 1352
BtsI GCAGTG 1 cut(s) 680
BtsIMutI CAGTG 1 cut(s) 680
BtuMI TCGCGA 1 cut(s) 585
BveI ACCTGC 1 cut(s) 973
Cac8I GCNNGC 1 cut(s) 1167
CciI TCATGA 1 cut(s) 301
CfoI GCGC 1 cut(s) 432
Cfr13I GGNCC 2 cut(s) 503, 602
ClaI ATCGAT 1 cut(s) 270
CviAII CATG 6 cut(s) 302, 338, 949, 1026, 1120, 1149
DdeI CTNAG 6 cut(s) 255, 420, 452, 518, 543, 596
DinI GGCGCC 1 cut(s) 431
Ecl136II GAGCTC 1 cut(s) 307
Eco24I GRGCYC 1 cut(s) 309
Eco31I GGTCTC 2 cut(s) 37, 955
Eco47I GGWCC 1 cut(s) 602
Eco53kI GAGCTC 1 cut(s) 307
Eco57I CTGAAG 1 cut(s) 706
Eco88I CYCGRG 1 cut(s) 849
EcoICRI GAGCTC 1 cut(s) 307
EcoO109I RGGNCCY 2 cut(s) 503, 602
EcoRI GAATTC 2 cut(s) 173, 1021
EcoT38I GRGCYC 1 cut(s) 309
EgeI GGCGCC 1 cut(s) 431
EheI GGCGCC 1 cut(s) 431
Esp3I CGTCTC 1 cut(s) 516
FaeI CATG 6 cut(s) 305, 341, 952, 1029, 1123, 1152
FalI AAGNNNNNCTT 2 cut(s) 852, 884
FatI CATG 6 cut(s) 301, 337, 948, 1025, 1119, 1148
FblI GTMKAC 1 cut(s) 458
FokI GGATG 2 cut(s) 681, 1359
FriOI GRGCYC 1 cut(s) 309
FspBI CTAG 4 cut(s) 83, 606, 1361, 1390
GlaI GCGC 1 cut(s) 431
HaeII RGCGCY 1 cut(s) 433
HaeIII GGCC 2 cut(s) 505, 1153
HapII CCGG 1 cut(s) 395
HhaI GCGC 1 cut(s) 432
Hin1I GRCGYC 1 cut(s) 430
Hin1II CATG 6 cut(s) 305, 341, 952, 1029, 1123, 1152
Hin6I GCGC 1 cut(s) 430
HinP1I GCGC 1 cut(s) 430
HindIII AAGCTT 1 cut(s) 1124
HinfI GANTC 5 cut(s) 65, 217, 267, 398, 737
HpaII CCGG 1 cut(s) 395
HphI GGTGA 4 cut(s) 570, 683, 746, 941
Hpy166II GTNNAC 4 cut(s) 459, 549, 611, 747
Hpy188I TCNGA 6 cut(s) 145, 475, 521, 725, 1018, 1322
Hpy8I GTNNAC 4 cut(s) 459, 549, 611, 747
HpyAV CCTTC 4 cut(s) 15, 238, 494, 679
HpyCH4III ACNGT 5 cut(s) 751, 815, 905, 919, 1208
HpyCH4IV ACGT 1 cut(s) 57
HpyCH4V TGCA 3 cut(s) 200, 242, 281
HpyF10VI GCNNNNNNNGC 2 cut(s) 436, 1291
HpyF3I CTNAG 6 cut(s) 255, 420, 452, 518, 543, 596
HpySE526I ACGT 1 cut(s) 57
Hsp92I GRCGYC 1 cut(s) 430
Hsp92II CATG 6 cut(s) 305, 341, 952, 1029, 1123, 1152
HspAI GCGC 1 cut(s) 430
KasI GGCGCC 1 cut(s) 429
Kpn2I TCCGGA 1 cut(s) 394
LmnI GCTCC 2 cut(s) 314, 1372
LweI GCATC 2 cut(s) 187, 934
MaeI CTAG 4 cut(s) 83, 606, 1361, 1390
MaeII ACGT 1 cut(s) 57
MaeIII GTNAC 4 cut(s) 62, 877, 974, 1230
MflI RGATCY 3 cut(s) 371, 998, 1132
MhlI GDGCHC 2 cut(s) 309, 595
MluCI AATT 9 cut(s) 173, 364, 403, 629, 1021, 1038, 1175, 1236, 1308
Mly113I GGCGCC 1 cut(s) 430
MlyI GAGTC 2 cut(s) 59, 211
MmeI TCCRAC 1 cut(s) 1160
MnlI CCTC 9 cut(s) 113, 419, 427, 516, 591, 593, 795, 822, 1331
MroI TCCGGA 1 cut(s) 394
MroXI GAANNNNTTC 2 cut(s) 150, 390
MseI TTAA 2 cut(s) 159, 167
MspI CCGG 1 cut(s) 395
Mva1269I GAATGC 1 cut(s) 1051
MvnI CGCG 1 cut(s) 585
MwoI GCNNNNNNNGC 2 cut(s) 436, 1291
NarI GGCGCC 1 cut(s) 430
NlaIII CATG 6 cut(s) 305, 341, 952, 1029, 1123, 1152
NlaIV GGNNCC 2 cut(s) 431, 1000
NmuCI GTSAC 2 cut(s) 62, 1230
NruI TCGCGA 1 cut(s) 585
PaeR7I CTCGAG 1 cut(s) 849
PagI TCATGA 1 cut(s) 301
PctI GAATGC 1 cut(s) 1051
PdmI GAANNNNTTC 2 cut(s) 150, 390
PfeI GAWTC 3 cut(s) 267, 398, 737
PleI GAGTC 2 cut(s) 59, 211
PluTI GGCGCC 1 cut(s) 433
PpsI GAGTC 2 cut(s) 59, 211
PpuMI RGGWCCY 1 cut(s) 602
Psp124BI GAGCTC 1 cut(s) 309
Psp5II RGGWCCY 1 cut(s) 602
PspN4I GGNNCC 2 cut(s) 431, 1000
PspPI GGNCC 2 cut(s) 503, 602
PspPPI RGGWCCY 1 cut(s) 602
PspXI VCTCGAGB 1 cut(s) 849
PsuI RGATCY 3 cut(s) 371, 998, 1132
RruI TCGCGA 1 cut(s) 585
SacI GAGCTC 1 cut(s) 309
SaqAI TTAA 2 cut(s) 159, 167
Sau96I GGNCC 2 cut(s) 503, 602
SchI GAGTC 2 cut(s) 59, 211
SduI GDGCHC 2 cut(s) 309, 595
SfaNI GCATC 2 cut(s) 187, 934
SfoI GGCGCC 1 cut(s) 431
Sfr274I CTCGAG 1 cut(s) 849
SinI GGWCC 1 cut(s) 602
SlaI CTCGAG 1 cut(s) 849
SmlI CTYRAG 1 cut(s) 849
SmoI CTYRAG 1 cut(s) 849
SpeI ACTAGT 1 cut(s) 1360
Sse9I AATT 9 cut(s) 173, 364, 403, 629, 1021, 1038, 1175, 1236, 1308
SsiI CCGC 1 cut(s) 106
SspDI GGCGCC 1 cut(s) 429
SspMI CTAG 4 cut(s) 83, 606, 1361, 1390
SstI GAGCTC 1 cut(s) 309
TaaI ACNGT 5 cut(s) 751, 815, 905, 919, 1208
TaiI ACGT 1 cut(s) 60
TaqI TCGA 5 cut(s) 39, 265, 270, 368, 850
TasI AATT 9 cut(s) 173, 364, 403, 629, 1021, 1038, 1175, 1236, 1308
TfiI GAWTC 3 cut(s) 267, 398, 737
Tru1I TTAA 2 cut(s) 159, 167
Tru9I TTAA 2 cut(s) 159, 167
TscAI CASTG 1 cut(s) 680
TseFI GTSAC 2 cut(s) 62, 1230
Tsp45I GTSAC 2 cut(s) 62, 1230
TspGWI ACGGA 4 cut(s) 50, 301, 364, 852
TspRI CASTG 1 cut(s) 680
VpaK11BI GGWCC 1 cut(s) 602
XapI RAATTY 6 cut(s) 173, 1021, 1038, 1175, 1236, 1308
XcmI CCANNNNNNNNNTGG 1 cut(s) 701
XhoI CTCGAG 1 cut(s) 849
XmiI GTMKAC 1 cut(s) 458
XmnI GAANNNNTTC 2 cut(s) 150, 390
XspI CTAG 4 cut(s) 83, 606, 1361, 1390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.