Rh6AG401800

B3 domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000210
Physical Location & Seq
Reverse (-)
59927579 .. 59930041
2463 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG401800.1

Sequence Viewer

Length: 420 bp
ATGGGAGGCGATCAAGTCATGTCTGGGAAGGCTGTAATTGAAGAAACACCAACTGGATTGACGGTGTTCCAATCAAGGAATTCATGTTTCATGAAAACTTTGGAGACATATAGACGTTACGATCTGACGATTCCGCAGAAAATAGTGAAAGCTGAGGGTCTTAAGGGACACATGTCTCTAACGCTTCGAGATCCAGAAAAGAGATCACGGATTGTTGAGACTGATGTCACCCTAGATAAACGTTTGAAGCTGACAAAAGGTTGGTGCCAAGGATGCAGGGAGTTCAACATCTCAATTGGGGACAAGGTTGTTTTCGAGTTTGTCAAGCCAAATGTGATTCAACTTCATATCTTCAGAGGCAAAGATGTGCTACTCTCAGGTCCTAAAGTTGTGGACTCTAGCAACTATAGGCAAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B3

Protein Analysis

139

Amino Acids

15.81

Weight (kDa)

9.48

Isoelectric Point (pI)

44.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B3 PF02362 31 - 119 1.4e-08 B3 DNA binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000210)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G66980
fragaria_vesca FvH4_2g27400 FvH4_2g27400 FvH4_2g27400 FvH4_2g40960 FvH4_2g40960 FvH4_2g40960 FvH4_2g40960 FvH4_2g40960 FvH4_3g19710 FvH4_5g30470 FvH4_6g23740 FvH4_6g23740 FvH4_6g23740 FvH4_6g23740 FvH4_6g23740 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g01780 FvH4_7g23440 FvH4_7g23440 FvH4_7g23440
malus_domestica MD03G1230100.v1.1 MD03G1230200.v1.1 MD04G1034500.v1.1 MD04G1034600.v1.1 MD08G1039500.v1.1 MD11G1250800.v1.1 MD11G1251100.v1.1 MD11G1251200.v1.1
prunus_persica Prupe.1G388000_v2.0.a1 Prupe.1G388000_v2.0.a1 Prupe.1G388100_v2.0.a1 Prupe.4G178000_v2.0.a1 Prupe.4G178100_v2.0.a1 Prupe.4G178100_v2.0.a1 Prupe.4G178200_v2.0.a1 Prupe.4G178300_v2.0.a1 Prupe.4G178400_v2.0.a1 Prupe.4G178500_v2.0.a1 Prupe.4G206300_v2.0.a1 Prupe.4G206300_v2.0.a1 Prupe.4G206800_v2.0.a1 Prupe.4G206900_v2.0.a1 Prupe.4G207000_v2.0.a1 Prupe.7G064600_v2.0.a1 Prupe.7G064600_v2.0.a1
pyrus_communis pycom03g17770 pycom04g02860 pycom04g02870 pycom08g03160 pycom11g22190 pycom11g22200 pycom11g22210 pycom11g22220
rosa_chinensis RchiOBHm_Chr1g0318651 RchiOBHm_Chr1g0318881 RchiOBHm_Chr1g0319011 RchiOBHm_Chr1g0356381 RchiOBHm_Chr3g0482191 RchiOBHm_Chr5g0033031 RchiOBHm_Chr5g0033041 RchiOBHm_Chr6g0296251 RchiOBHm_Chr6g0299611 RchiOBHm_Chr7g0208501 RchiOBHm_Chr7g0224941
rosa_laevigata RLG00000001845 RLG00000011405 RLG00000011713 RLG00000023362 RLG00000030508 RLG00000030520 RLG00000033444
rosa_multiflora Rmu_sc0000307.1_g000013 Rmu_sc0000986.1_g000010 Rmu_sc0000986.1_g000011 Rmu_sc0002895.1_g000002 Rmu_sc0003503.1_g000005 Rmu_ssc0000357.1_g000023
rosa_roxburghii Rroxscaffold_1G00046900 Rroxscaffold_1G00046920 Rroxscaffold_1G00046930 Rroxscaffold_1G00046940 Rroxscaffold_1G00047010 Rroxscaffold_1G00047020 Rroxscaffold_1G00047030 Rroxscaffold_1G00059830 Rroxscaffold_3G00234250 Rroxscaffold_4G00299610 Rroxscaffold_4G00321350 Rroxscaffold_4G00328680 Rroxscaffold_4G00329000 Rroxscaffold_6G00399560 Rroxscaffold_6G00399970 Rroxscaffold_7G00168510 Rroxscaffold_7G00171700 Rroxscaffold_7G00178360
rosa_rugosa Rorug01G0022500 Rorug01G0022800 Rorug01G0026400 Rorug03G0195600 Rorug05G0135400 Rorug06G0260100 Rorug06G0260200.1 Rorug06G0291000 Rorug06G0291100 Rorug06G0291100 Rorug07G0227000
rosa_samantha Rh1AG035600 Rh1AG038500 Rh1AG045500 Rh1BG031400 Rh1BG034700 Rh1CG034500 Rh1CG037200 Rh1CG048500 Rh1DG032800 Rh1DG035800 Rh1DG052700 Rh3AG247000 Rh3CG277700 Rh3DG274200 Rh5AG227900 Rh5AG228000 Rh5CG256800 Rh5CG256900 Rh5CG257100 Rh5DG234000 Rh5DG234200 Rh6AG401800 Rh6BG380000 Rh6BG410200 Rh6CG385400 Rh6CG415800 Rh6DG372600 Rh6DG403000 Rh7AG376300 Rh7BG362400 Rh7DG372500
rosa_wichuraiana Rw0G008540 Rw1G002780 Rw1G002970 Rw3G022090 Rw5G020870 Rw6G032430 Rw6G035160 Rw7G031430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 264
AciI CCGC 1 cut(s) 134
AclI AACGTT 1 cut(s) 241
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 337
AflII CTTAAG 1 cut(s) 161
AflIII ACRYGT 1 cut(s) 171
AgsI TTSAA 4 cut(s) 41, 247, 286, 341
AluBI AGCT 2 cut(s) 152, 250
AluI AGCT 2 cut(s) 152, 250
Alw26I GTCTC 3 cut(s) 98, 180, 212
AlwI GGATC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 380
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 380
BanI GGYRCC 1 cut(s) 264
BbvCI CCTCAGC 1 cut(s) 153
BcoDI GTCTC 3 cut(s) 98, 180, 212
BfaI CTAG 3 cut(s) 233, 399, 418
BfmI CTRYAG 1 cut(s) 406
BfrI CTTAAG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 380
BmgT120I GGNCC 1 cut(s) 380
BmiI GGNNCC 1 cut(s) 266
BmsI GCATC 1 cut(s) 263
BoxI GACNNNNGTC 2 cut(s) 172, 224
Bpu10I CCTNAGC 1 cut(s) 153
BsaJI CCNNGG 1 cut(s) 268
Bse1I ACTGG 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 268
BseGI GGATG 1 cut(s) 278
BseMII CTCAG 2 cut(s) 144, 390
BseNI ACTGG 1 cut(s) 58
BshNI GGYRCC 1 cut(s) 264
BslFI GGGAC 2 cut(s) 180, 314
BsmAI GTCTC 3 cut(s) 98, 180, 212
BsmFI GGGAC 2 cut(s) 180, 314
Bsp143I GATC 4 cut(s) 10, 121, 190, 203
BspACI CCGC 1 cut(s) 134
BspCNI CTCAG 2 cut(s) 145, 389
BspHI TCATGA 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 266
BspPI GGATC 1 cut(s) 185
BspT107I GGYRCC 1 cut(s) 264
BspTI CTTAAG 1 cut(s) 161
BsrI ACTGG 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 268
BssMI GATC 4 cut(s) 10, 121, 190, 203
BssT1I CCWWGG 1 cut(s) 268
Bst4CI ACNGT 1 cut(s) 64
BstAFI CTTAAG 1 cut(s) 161
BstDEI CTNAG 2 cut(s) 153, 376
BstF5I GGATG 1 cut(s) 278
BstKTI GATC 4 cut(s) 13, 124, 193, 206
BstMAI GTCTC 3 cut(s) 98, 180, 212
BstMBI GATC 4 cut(s) 10, 121, 190, 203
BstMWI GCNNNNNNNGC 1 cut(s) 273
BstNSI RCATGY 1 cut(s) 175
BstPAI GACNNNNGTC 2 cut(s) 172, 224
BstSFI CTRYAG 1 cut(s) 406
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtsCI GGATG 1 cut(s) 278
CciI TCATGA 1 cut(s) 90
Cfr13I GGNCC 1 cut(s) 380
CviAII CATG 4 cut(s) 19, 84, 91, 172
CviJI RGCY 4 cut(s) 32, 152, 250, 328
CviKI_1 RGCY 4 cut(s) 32, 152, 250, 328
DdeI CTNAG 2 cut(s) 153, 376
DpnI GATC 4 cut(s) 12, 123, 192, 205
DpnII GATC 4 cut(s) 10, 121, 190, 203
Eco130I CCWWGG 1 cut(s) 268
Eco47I GGWCC 1 cut(s) 380
Eco57I CTGAAG 1 cut(s) 337
EcoO109I RGGNCCY 1 cut(s) 380
EcoRI GAATTC 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 268
ErhI CCWWGG 1 cut(s) 268
FaeI CATG 4 cut(s) 22, 87, 94, 175
FaiI YATR 8 cut(s) 20, 85, 92, 109, 111, 173, 348, 408
FaqI GGGAC 2 cut(s) 180, 314
FatI CATG 4 cut(s) 18, 83, 90, 171
FokI GGATG 1 cut(s) 285
FspBI CTAG 3 cut(s) 233, 399, 418
Hin1II CATG 4 cut(s) 22, 87, 94, 175
HinfI GANTC 3 cut(s) 130, 337, 395
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 394
Hpy188I TCNGA 2 cut(s) 126, 356
Hpy188III TCNNGA 3 cut(s) 91, 188, 194
Hpy8I GTNNAC 1 cut(s) 394
HpyAV CCTTC 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4IV ACGT 2 cut(s) 115, 241
HpyCH4V TGCA 1 cut(s) 276
HpyF10VI GCNNNNNNNGC 1 cut(s) 273
HpyF3I CTNAG 2 cut(s) 153, 376
HpySE526I ACGT 2 cut(s) 115, 241
Hsp92II CATG 4 cut(s) 22, 87, 94, 175
Kzo9I GATC 4 cut(s) 10, 121, 190, 203
LpnPI CCDG 5 cut(s) 9, 39, 207, 262, 363
LweI GCATC 1 cut(s) 263
MaeI CTAG 3 cut(s) 233, 399, 418
MaeII ACGT 2 cut(s) 115, 241
MaeIII GTNAC 2 cut(s) 116, 226
MalI GATC 4 cut(s) 12, 123, 192, 205
MboI GATC 4 cut(s) 10, 121, 190, 203
MboII GAAGA 2 cut(s) 53, 343
MfeI CAATTG 1 cut(s) 294
MflI RGATCY 1 cut(s) 190
MluCI AATT 3 cut(s) 36, 79, 294
MlyI GAGTC 1 cut(s) 389
MnlI CCTC 2 cut(s) 148, 350
MseI TTAA 1 cut(s) 162
MspCI CTTAAG 1 cut(s) 161
MunI CAATTG 1 cut(s) 294
MwoI GCNNNNNNNGC 1 cut(s) 273
NdeII GATC 4 cut(s) 10, 121, 190, 203
NlaIII CATG 4 cut(s) 22, 87, 94, 175
NlaIV GGNNCC 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 226
NspI RCATGY 1 cut(s) 175
PagI TCATGA 1 cut(s) 90
PciI ACATGT 1 cut(s) 171
PfeI GAWTC 2 cut(s) 130, 337
PleI GAGTC 1 cut(s) 389
PpsI GAGTC 1 cut(s) 389
PpuMI RGGWCCY 1 cut(s) 380
PscI ACATGT 1 cut(s) 171
PshAI GACNNNNGTC 2 cut(s) 172, 224
Psp1406I AACGTT 1 cut(s) 241
Psp5II RGGWCCY 1 cut(s) 380
PspN4I GGNNCC 1 cut(s) 266
PspPI GGNCC 1 cut(s) 380
PspPPI RGGWCCY 1 cut(s) 380
PsuI RGATCY 1 cut(s) 190
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 4 cut(s) 10, 121, 190, 203
Sau96I GGNCC 1 cut(s) 380
SchI GAGTC 1 cut(s) 389
SetI ASST 7 cut(s) 118, 154, 244, 252, 262, 309, 382
SfaNI GCATC 1 cut(s) 263
SfcI CTRYAG 1 cut(s) 406
SinI GGWCC 1 cut(s) 380
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 3 cut(s) 36, 79, 294
SsiI CCGC 1 cut(s) 134
SspMI CTAG 3 cut(s) 233, 399, 418
StyI CCWWGG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 64
TaiI ACGT 2 cut(s) 118, 244
TaqI TCGA 2 cut(s) 187, 315
TasI AATT 3 cut(s) 36, 79, 294
TfiI GAWTC 2 cut(s) 130, 337
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseFI GTSAC 1 cut(s) 226
Tsp45I GTSAC 1 cut(s) 226
TspDTI ATGAA 4 cut(s) 72, 79, 107, 335
TspGWI ACGGA 1 cut(s) 223
Vha464I CTTAAG 1 cut(s) 161
VpaK11BI GGWCC 1 cut(s) 380
XapI RAATTY 1 cut(s) 79
XceI RCATGY 1 cut(s) 175
XspI CTAG 3 cut(s) 233, 399, 418
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.