Rmu_sc0003115.1_g000001

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003115.1
Physical Location & Seq
Reverse (-)
2 .. 4730
4729 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003115.1_g000001.1.cds

Sequence Viewer

Length: 4729 bp
atggagttgggaaggtggctcaaacatgcttatgcaatatcaattgtgcttcttctgcatatcaacgcttccttatccctcggccaccaccatgctaacgtgacggaaaggtgcctagagagggagagggatgcactccttgctatcaaaggagacctggtggatgaatacaacctgctctcttcgtggggaagcgaagcccaaaagcgagactgttgcggatgggaaagagtccactgcgatcaccagactggccatgttattcaactgcatctgaatgcagaaatgaaggagatctctttgcaaggtaagtaccgtgagcatatacataaaactttgcaaggtgaaattagtcctaaaatcattgagttgcagcatttggaatatttgaacctcagtgacaattccttcactgccagccaaattccagcactcatttgttctctatccaatttaagacacctagatctcagtttcaatgacctctcttggagcaaaattccaaagctcattggtaatctgaccaatttaatatatctagatctctttgggaatgaattaggtgatgaaattccatatcatcagcttggaaaccttactcatttgcagtatctcaatctcgggtataatttcttcactctagttggaggaaacctcaattggctctcacatctttcttctttaaaatacctggacttgagtttcacgagtctaagtaaggtttctgattggctggaaacaataaacaagctccctgacctaagaaacttgaccttaagtagatgtgatcttcctcctccaattctttccactctttctcacataaattcttccaattctcttgtaagtgttgacctctcttccaaccaattaagcggtttgattccccatgcttttgcaaacatgagctcacttgcatatcttgacctctctttaaaccaattaagtggtttgcttcccgatgcttttgcaaacatgagctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattccctatgcttttgcaaacatgagctcacttgcaactcttgacctctcttccaaccaattaagcggtttgattccccatgcttttgcaagcatgagctcacttgcaactcttgacctctcttccaaccaattaaggagtttgattcccaatgcttttgcaaacatgagctcacttgcaactcttgacctctcttccaaccaattaagcggtttgattccccatgcttttgcaagcatgagctcacttgcaactcttgacctctcttccaaccaattaagcggtttgattcccaatgcttttgcaaacatgagctcacttgcaactcttgacctctcttacaaccaattaagcggtttgattcccgatgctttcaaaaatatgaattcacttgcatatcttggactccgtgatatccaattaagcggtttgattcccgatgctttcaaaaatatgaattcacttgcatatcttgacctctctttaaaccaattaagtggtttgcttcccgatgcttttgcaaacatgagctcacttgcaactcttgacctctcttccaaccaattaagcggtttgattccccatgcttttgcaagcatgagctcacttgcaactcttgacctctcttccaaccaattaagaggtttgattcccgatgcttttgcaagcatgagctcacttgcaactcttgacctctcttccaaccaattaagtggtttggttcccgatgtttttgcaaacatgagctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgcaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgggctcacttgtaactcttgacctctcttccaaccaattaagtggtttgattcccgatgcttttgcaaacatgagctcacttgcaactcttgacctctctaataaccaacttgaaggaggaatcccagcatccattggccagttgtgtaatttgcgaaacttggccatttcactcagcaggttgcgtggacaactctctgaatttgttcaagcatcgtctatatgtactcaaaactcattggagaaattggatctctctcataatgatcttgctgggttttttcctaatcttgcaaactttcaatcattgaaggaattatatctctctaaaaaccagttgagtggaatcatttctgatagtattggaaagttgtcttctttgatgacattagatctcaaagaaaataggttaagcggaatgataccggagagtattgggcaaatgtcattgttgagagagttgtatctacagggaaaccaacttagtggaatgataccggagagtattgggaaattgtcagccttgctaacattagatctctccggtaatcgattaagcgggcaagtacctgaaagtattggacaatgctcagaactggtcgatatgaatcttagtaagaattctttggaaggggtaatttcggaagttcatttgtcaaaactgtccggattaattggtttggatttatccgataacccattagttttcaaagtcagttctgattgggttcctccttttaaattggattctttaagtttgaaatcatgcaaggtcgggcggtatttcccaaactggcttcgaactcaacaaggtcttttcgaacttgatatttcttatgctggaatttcagatgtacttccaagttggttctggagtcttgttggtaacaccatgactcagaaaatagatatctctcataatcaaattagaggaacatttgagagtttaacattgaatgctacatcattgcctggagttgaagttcatttcgcgtccaatcaattcgaaggttcaataccgtcaattctatttgctgcttcatatttggatctctccaataataagttttcagacatgacatccttgtgtgttacttcagagcttcaaagtttaaagtttcttgatctctcaggcaatcatatttcaggagaaattccagattgttggagacatttggtctctctaaaactactcgatttgggtagcaatgctttttatgggaaaatcccaaccactataggcactttatttcaaatggaaacattgaaattgagaagcaacaaacttgtgggagaaatgacttcatccttgaagaattgtaagagcttaaaagtgattgatctcggagaaaataagctttcaggatcagtccctgaatggttgggtgttagctttccaaatttggttatactaatgcttcaatctaatcagtttagagggagcttgccttcacagttatgtaatttaacgcacattcagattttggatttctctgtgaacgaaatctctggaactatacctaaatgcctcaataatttgacttctttaactcaaggaggaaattcaagtctaaccatcagacattcttttcatccatctattgcacacgcacctatatctgaggaagcacctagcggaagtacgccctcgccaccgccacctccgatgccatctgattactacgaggacaatgcaaccttcatttggaaaggaagaatgtcagcatacaaaagtattttgggacttgtcaagagaattgatctctcaagcaacaaaataactggggaaattccaagtgagatcactcatcttgttggtttggtttctttgaacctttcaagaaaccatctaacaggacatattccttcacagattggaaagttgcaggcattagattctcttgatttgtcaagaaaccagataaatggggtgattccaacaagccttgctcggatcgaccgacttgcttacttggacctgtcatacaacaacttatctggcgaaattccaactggtactcaactccaagaccctttctcttttgctggaaatcttaaattgtgtggatttccactcaaaaagatttgtgatccggaaggaaacggtcggccaaatgtctcgagcaatgaagaagatccagatgagctcatcacgctgggtttctacataagtctaggagttggatttactgttggattttggggagtctccgggagtttgatattcaagaggtcatggagatatgcatactacaacttcttgaatgcttcaaatgattggctttatgtgaaggtagctttgatcagacggc

Protein Analysis

1576

Amino Acids

170.08

Weight (kDa)

5.01

Isoelectric Point (pI)

32.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000028)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g45420 FvH4_4g14031 FvH4_5g20780 FvH4_6g28530 FvH4_7g14020 FvH4_7g14030 FvH4_7g14040 FvH4_7g14050 FvH4_7g14060 FvH4_7g14070 FvH4_7g14090 FvH4_7g14110 FvH4_7g14140 FvH4_7g14450
malus_domestica MD00G1189100.v1.1 MD01G1018600.v1.1 MD01G1053800.v1.1 MD01G1053900.v1.1 MD01G1054000.v1.1 MD01G1054100.v1.1 MD01G1056700.v1.1 MD01G1057000.v1.1 MD01G1057300.v1.1 MD01G1057400.v1.1 MD01G1061600.v1.1 MD01G1061800.v1.1 MD01G1061900.v1.1 MD01G1062000.v1.1 MD01G1062400.v1.1 MD01G1062500.v1.1 MD01G1063200.v1.1 MD01G1063300.v1.1 MD01G1063400.v1.1 MD01G1063700.v1.1 MD01G1063900.v1.1 MD01G1064200.v1.1 MD01G1064300.v1.1 MD01G1064400.v1.1 MD01G1064600.v1.1 MD01G1064700.v1.1 MD01G1181100.v1.1 MD01G1212300.v1.1 MD01G1212500.v1.1 MD01G1212600.v1.1 MD02G1271900.v1.1 MD07G1136500.v1.1 MD07G1139300.v1.1 MD07G1141200.v1.1 MD07G1144700.v1.1 MD08G1144200.v1.1 MD14G1186300.v1.1 MD14G1186500.v1.1 MD14G1186700.v1.1 MD14G1186800.v1.1 MD15G1351300.v1.1 MD15G1439500.v1.1
prunus_persica Prupe.1G067000_v2.0.a1 Prupe.2G077400_v2.0.a1 Prupe.2G077700_v2.0.a1 Prupe.2G078100_v2.0.a1 Prupe.2G078100_v2.0.a1 Prupe.2G078600_v2.0.a1 Prupe.2G078800_v2.0.a1 Prupe.2G099600_v2.0.a1 Prupe.2G099700_v2.0.a1 Prupe.2G155100_v2.0.a1 Prupe.2G155500_v2.0.a1 Prupe.2G155600_v2.0.a1 Prupe.2G155800_v2.0.a1 Prupe.2G155900_v2.0.a1 Prupe.2G156100_v2.0.a1 Prupe.2G166100_v2.0.a1 Prupe.2G166300_v2.0.a1 Prupe.2G167500_v2.0.a1 Prupe.2G167600_v2.0.a1 Prupe.2G167600_v2.0.a1 Prupe.2G167600_v2.0.a1 Prupe.2G167700_v2.0.a1 Prupe.2G167700_v2.0.a1 Prupe.2G168400_v2.0.a1 Prupe.2G168700_v2.0.a1 Prupe.2G168800_v2.0.a1 Prupe.2G169000_v2.0.a1 Prupe.2G169100_v2.0.a1 Prupe.2G169200_v2.0.a1 Prupe.2G169500_v2.0.a1 Prupe.2G171500_v2.0.a1 Prupe.2G171500_v2.0.a1 Prupe.2G172300_v2.0.a1 Prupe.2G304800_v2.0.a1 Prupe.4G264800_v2.0.a1 Prupe.4G265000_v2.0.a1 Prupe.5G051900_v2.0.a1 Prupe.5G052000_v2.0.a1
pyrus_communis pycom01g08380 pycom01g08430 pycom01g08490 pycom01g08520 pycom01g08540 pycom01g08550 pycom01g08600 pycom01g08630 pycom01g08660 pycom01g08720 pycom01g09180 pycom01g09200 pycom01g09210 pycom01g09270 pycom01g09280 pycom01g09300 pycom01g09380 pycom01g19110 pycom01g22260 pycom01g22310 pycom01g22330 pycom01g22350 pycom01g22360 pycom02g23250 pycom07g13420 pycom07g13670 pycom07g13900 pycom07g13910 pycom07g13960 pycom07g13970 pycom07g25680 pycom11g22830
rosa_chinensis RchiOBHm_Chr0c22g0500431 RchiOBHm_Chr0c22g0500441 RchiOBHm_Chr0c22g0500561 RchiOBHm_Chr0c22g0500571 RchiOBHm_Chr0c22g0500611 RchiOBHm_Chr0c22g0500621 RchiOBHm_Chr0c22g0500631 RchiOBHm_Chr0c22g0500681 RchiOBHm_Chr1g0348221 RchiOBHm_Chr1g0348251 RchiOBHm_Chr1g0352861 RchiOBHm_Chr1g0352871 RchiOBHm_Chr1g0352891 RchiOBHm_Chr1g0352901 RchiOBHm_Chr1g0354671 RchiOBHm_Chr1g0354701 RchiOBHm_Chr1g0354711 RchiOBHm_Chr1g0354751 RchiOBHm_Chr1g0354761 RchiOBHm_Chr1g0354841 RchiOBHm_Chr1g0354851 RchiOBHm_Chr1g0354881 RchiOBHm_Chr1g0354971 RchiOBHm_Chr1g0354981 RchiOBHm_Chr1g0354991 RchiOBHm_Chr1g0355001 RchiOBHm_Chr1g0355011 RchiOBHm_Chr1g0355021 RchiOBHm_Chr1g0355861 RchiOBHm_Chr1g0379671 RchiOBHm_Chr1g0379681 RchiOBHm_Chr2g0096591 RchiOBHm_Chr2g0132821 RchiOBHm_Chr3g0454901 RchiOBHm_Chr3g0472711 RchiOBHm_Chr4g0400791 RchiOBHm_Chr5g0069481 RchiOBHm_Chr5g0069511 RchiOBHm_Chr5g0069551 RchiOBHm_Chr6g0254651 RchiOBHm_Chr6g0259721 RchiOBHm_Chr7g0205911 RchiOBHm_Chr7g0206401 RchiOBHm_Chr7g0206571 RchiOBHm_Chr7g0206581 RchiOBHm_Chr7g0206621 RchiOBHm_Chr7g0206631 RchiOBHm_Chr7g0206641 RchiOBHm_Chr7g0206681 RchiOBHm_Chr7g0206691 RchiOBHm_Chr7g0206751 RchiOBHm_Chr7g0206761 RchiOBHm_Chr7g0206851 RchiOBHm_Chr7g0206911 RchiOBHm_Chr7g0206921 RchiOBHm_Chr7g0207001 RchiOBHm_Chr7g0207011 RchiOBHm_Chr7g0207031 RchiOBHm_Chr7g0207101 RchiOBHm_Chr7g0207161 RchiOBHm_Chr7g0207201 RchiOBHm_Chr7g0207271 RchiOBHm_Chr7g0207301 RchiOBHm_Chr7g0207311 RchiOBHm_Chr7g0207421 RchiOBHm_Chr7g0207481 RchiOBHm_Chr7g0207491 RchiOBHm_Chr7g0207501 RchiOBHm_Chr7g0207521 RchiOBHm_Chr7g0207531 RchiOBHm_Chr7g0207561 RchiOBHm_Chr7g0207571 RchiOBHm_Chr7g0207581 RchiOBHm_Chr7g0207601 RchiOBHm_Chr7g0207621 RchiOBHm_Chr7g0207631 RchiOBHm_Chr7g0207651 RchiOBHm_Chr7g0207661 RchiOBHm_Chr7g0207711 RchiOBHm_Chr7g0207761 RchiOBHm_Chr7g0207801 RchiOBHm_Chr7g0208821 RchiOBHm_Chr7g0208831 RchiOBHm_Chr7g0208841 RchiOBHm_Chr7g0213601 RchiOBHm_Chr7g0215981 RchiOBHm_Chr7g0216021
rosa_laevigata RLG00000003193 RLG00000003194 RLG00000003287 RLG00000003288 RLG00000003289 RLG00000003293 RLG00000003294 RLG00000003295 RLG00000003297 RLG00000003299 RLG00000003301 RLG00000003327 RLG00000003347 RLG00000016653 RLG00000018642 RLG00000018643 RLG00000019285 RLG00000022542 RLG00000026368 RLG00000026371 RLG00000028124 RLG00000028125 RLG00000028183 RLG00000028184 RLG00000028185 RLG00000028188 RLG00000028673 RLG00000029267 RLG00000029325 RLG00000029674 RLG00000032883 RLG00000036055 RLG00000036058 RLG00000036065 RLG00000036068 RLG00000036071 RLG00000036072 RLG00000036075 RLG00000036076
rosa_multiflora Rmu_co8250183.1_g000001 Rmu_co8271981.1_g000001 Rmu_co8410829.1_g000001 Rmu_co8432879.1_g000001 Rmu_co8441941.1_g000001 Rmu_sc0000076.1_g000031 Rmu_sc0000738.1_g000038 Rmu_sc0000848.1_g000003 Rmu_sc0000848.1_g000014 Rmu_sc0000848.1_g000015 Rmu_sc0000848.1_g000016 Rmu_sc0001264.1_g000001 Rmu_sc0002284.1_g000018 Rmu_sc0002356.1_g000011 Rmu_sc0003020.1_g000003 Rmu_sc0003115.1_g000001 Rmu_sc0003115.1_g000002 Rmu_sc0003115.1_g000003 Rmu_sc0003115.1_g000004 Rmu_sc0003115.1_g000005 Rmu_sc0003115.1_g000008 Rmu_sc0003115.1_g000010 Rmu_sc0003115.1_g000011 Rmu_sc0003115.1_g000014 Rmu_sc0003565.1_g000002 Rmu_sc0003652.1_g000013 Rmu_sc0003652.1_g000015 Rmu_sc0003652.1_g000016 Rmu_sc0003652.1_g000019 Rmu_sc0003940.1_g000001 Rmu_sc0003940.1_g000004 Rmu_sc0003940.1_g000009 Rmu_sc0004084.1_g000010 Rmu_sc0004705.1_g000021 Rmu_sc0004972.1_g000007 Rmu_sc0004987.1_g000002 Rmu_sc0004987.1_g000006 Rmu_sc0005065.1_g000018 Rmu_sc0005065.1_g000029 Rmu_sc0005391.1_g000002 Rmu_sc0005633.1_g000003 Rmu_sc0005633.1_g000008 Rmu_sc0006632.1_g000014 Rmu_sc0006632.1_g000018 Rmu_sc0006681.1_g000010 Rmu_sc0006681.1_g000011 Rmu_sc0006733.1_g000003 Rmu_sc0007385.1_g000005 Rmu_sc0007385.1_g000007 Rmu_sc0007385.1_g000009 Rmu_sc0007385.1_g000016 Rmu_sc0007645.1_g000002 Rmu_sc0007645.1_g000003 Rmu_sc0007645.1_g000022 Rmu_sc0007828.1_g000008 Rmu_sc0008509.1_g000003 Rmu_sc0008509.1_g000015 Rmu_sc0008509.1_g000016 Rmu_sc0008509.1_g000020 Rmu_sc0008509.1_g000030 Rmu_sc0008509.1_g000041 Rmu_sc0008756.1_g000001 Rmu_sc0008756.1_g000003 Rmu_sc0013028.1_g000002 Rmu_sc0013028.1_g000003 Rmu_sc0013028.1_g000005 Rmu_sc0013160.1_g000001 Rmu_sc0014454.1_g000009 Rmu_sc0014455.1_g000007 Rmu_sc0014659.1_g000004 Rmu_sc0017798.1_g000002 Rmu_sc0017798.1_g000004 Rmu_sc0029608.1_g000001 Rmu_sc0037861.1_g000001 Rmu_sc0038750.1_g000001 Rmu_sc0042995.1_g000001 Rmu_ssc0000161.1_g000017
rosa_roxburghii Rroxscaffold_1G00009180 Rroxscaffold_1G00009190 Rroxscaffold_1G00011450 Rroxscaffold_1G00011480 Rroxscaffold_2G00111660 Rroxscaffold_2G00113570 Rroxscaffold_2G00122140 Rroxscaffold_3G00243730 Rroxscaffold_3G00245750 Rroxscaffold_3G00245760 Rroxscaffold_3G00250220 Rroxscaffold_3G00251160 Rroxscaffold_3G00251270 Rroxscaffold_3G00251280 Rroxscaffold_3G00251300 Rroxscaffold_3G00251340 Rroxscaffold_3G00251350 Rroxscaffold_3G00251390 Rroxscaffold_3G00251400 Rroxscaffold_3G00251560 Rroxscaffold_3G00251570 Rroxscaffold_3G00251870 Rroxscaffold_3G00252200 Rroxscaffold_3G00252210 Rroxscaffold_4G00279970 Rroxscaffold_4G00299970 Rroxscaffold_4G00300760 Rroxscaffold_4G00300780 Rroxscaffold_4G00300810 Rroxscaffold_4G00300850 Rroxscaffold_4G00307080 Rroxscaffold_4G00307100 Rroxscaffold_4G00313990 Rroxscaffold_6G00405080
rosa_rugosa Rorug01G0193600 Rorug01G0193700 Rorug01G0243800 Rorug01G0244000 Rorug01G0244000 Rorug01G0244400 Rorug01G0414300.1 Rorug01G0414500 Rorug01G0414600 Rorug02G0235600 Rorug02G0307900 Rorug02G0583100 Rorug02G0583200 Rorug02G0583300 Rorug05G0398000 Rorug05G0398100 Rorug05G0398200 Rorug05G0580300 Rorug05G0590300 Rorug06G0116000 Rorug06G0116100 Rorug07G0096800 Rorug07G0097100.1 Rorug07G0097200 Rorug07G0098600 Rorug07G0098600 Rorug07G0098700 Rorug07G0099100 Rorug07G0106100 Rorug07G0106200 Rorug07G0106200 Rorug07G0106300 Rorug07G0157600 Rorug07G0157700 Rorug07G0157700 Rorug07G0157800
rosa_samantha Rh1AG255500 Rh1AG256700 Rh1BG225800 Rh1BG226200 Rh1BG230000 Rh1CG195300 Rh1CG238400 Rh1CG238500 Rh1CG238900 Rh1CG239000 Rh1CG239300 Rh1CG239400 Rh1CG239800 Rh1CG240000 Rh1CG240200 Rh1CG240300 Rh1CG244300 Rh1CG406900 Rh1CG407300 Rh1CG407400 Rh2CG343600 Rh2DG383200 Rh3BG205900 Rh4AG404400 Rh4BG415500 Rh5AG455200 Rh5AG455600 Rh5CG497000 Rh5CG497200 Rh7AG228800 Rh7AG230400 Rh7AG230800 Rh7AG231200 Rh7AG231600 Rh7AG231800 Rh7AG232100 Rh7AG241600 Rh7BG236200 Rh7CG238200 Rh7CG239100 Rh7CG243400 Rh7CG244900
rosa_wichuraiana Rw0G023040 Rw1G017780 Rw1G022320 Rw1G022340 Rw1G022410 Rw1G022420 Rw1G022440 Rw1G022460 Rw1G022490 Rw1G022500 Rw1G022530 Rw1G022550 Rw1G022560 Rw1G022600 Rw1G023060 Rw1G038150 Rw1G038160 Rw2G008210 Rw2G022350 Rw2G029290 Rw4G015050 Rw4G019850 Rw5G024060 Rw5G042460 Rw7G019160 Rw7G019460 Rw7G019690 Rw7G019830 Rw7G019860 Rw7G019880 Rw7G019890 Rw7G019930 Rw7G019990 Rw7G020460 Rw7G025100 Rw7G025120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 183, 2586
AccB1I GGYRCC 1 cut(s) 111
AccII CGCG 1 cut(s) 3410
AccIII TCCGGA 2 cut(s) 3083, 4510
AclWI GGATC 6 cut(s) 2676, 3474, 3790, 4379, 4502, 4547
AcoI YGGCCR 5 cut(s) 82, 253, 2554, 2580, 4526
AcuI CTGAAG 1 cut(s) 3498
AfaI GTAC 6 cut(s) 314, 2644, 2985, 3273, 4060, 4435
AfiI CCNNNNNNNGG 2 cut(s) 121, 4122
AflII CTTAAG 1 cut(s) 775
AhdI GACNNNNNGTC 1 cut(s) 3593
AjnI CCWGG 3 cut(s) 156, 690, 3388
AjuI GAANNNNNNNTTGG 2 cut(s) 643, 675
AloI GAACNNNNNNTCC 2 cut(s) 3384, 3416
Alw26I GTCTC 6 cut(s) 147, 204, 3580, 3601, 4540, 4630
AlwI GGATC 6 cut(s) 2676, 3474, 3790, 4379, 4502, 4547
AlwNI CAGNNNCTG 1 cut(s) 3791
Ama87I CYCGRG 2 cut(s) 620, 4537
Aor13HI TCCGGA 2 cut(s) 3083, 4510
AoxI GGCC 5 cut(s) 82, 253, 2554, 2580, 4526
ApeKI GCWGC 2 cut(s) 373, 3452
AseI ATTAAT 1 cut(s) 3089
Asp700I GAANNNNTTC 2 cut(s) 2622, 2767
AspS9I GGNCC 1 cut(s) 4393
AsuC2I CCSGG 1 cut(s) 4630
AsuHPI GGTGA 4 cut(s) 236, 356, 575, 4360
AsuII TTCGAA 3 cut(s) 3217, 3237, 3423
AvaI CYCGRG 2 cut(s) 620, 4537
AvaII GGWCC 1 cut(s) 4393
BalI TGGCCA 3 cut(s) 255, 2556, 2582
BanI GGYRCC 1 cut(s) 111
BarI GAAGNNNNNNTAC 4 cut(s) 617, 649, 3417, 3449
BauI CACGAG 1 cut(s) 706
BbsI GAAGAC 1 cut(s) 2784
BbvI GCAGC 2 cut(s) 385, 3439
BccI CCATC 5 cut(s) 216, 4001, 4021, 4096, 4272
BciT130I CCWGG 3 cut(s) 158, 692, 3390
BclI TGATCA 1 cut(s) 4719
BcnI CCSGG 1 cut(s) 4630
BcoDI GTCTC 6 cut(s) 147, 204, 3580, 3601, 4540, 4630
BfaI CTAG 6 cut(s) 116, 464, 539, 641, 4050, 4592
BfmI CTRYAG 2 cut(s) 2885, 3654
BfrI CTTAAG 1 cut(s) 775
BfuAI ACCTGC 2 cut(s) 183, 2586
BglII AGATCT 5 cut(s) 294, 466, 541, 2809, 2953
BisI GCNGC 2 cut(s) 374, 3453
BlsI GCNGC 2 cut(s) 375, 3454
Bme1390I CCNGG 4 cut(s) 158, 692, 3390, 4630
Bme18I GGWCC 1 cut(s) 4393
BmeRI GACNNNNNGTC 1 cut(s) 3593
BmeT110I CYCGRG 2 cut(s) 620, 4537
BmgT120I GGNCC 1 cut(s) 4393
BmiI GGNNCC 3 cut(s) 113, 1749, 3147
BmrFI CCNGG 4 cut(s) 158, 692, 3390, 4630
BmrI ACTGGG 1 cut(s) 4209
BmuI ACTGGG 1 cut(s) 4209
BpiI GAAGAC 1 cut(s) 2784
BplI GAGNNNNNCTC 2 cut(s) 639, 671
BpmI CTGGAG 2 cut(s) 3310, 3411
Bpu14I TTCGAA 3 cut(s) 3217, 3237, 3423
BpuEI CTTGAG 3 cut(s) 718, 3954, 4168
BpuMI CCSGG 1 cut(s) 4630
Bsa29I ATCGAT 1 cut(s) 2968
BsaBI GATNNNNATC 1 cut(s) 3024
BsaI GGTCTC 2 cut(s) 147, 3601
BsaJI CCNNGG 1 cut(s) 79
BsaWI WCCGGW 5 cut(s) 2842, 2914, 2960, 3083, 4510
BsaXI ACNNNNNCTCC 4 cut(s) 144, 174, 3384, 3414
Bsc4I CCNNNNNNNGG 2 cut(s) 121, 4122
Bse1I ACTGG 7 cut(s) 256, 2557, 2752, 3018, 3215, 4204, 4435
Bse3DI GCAATG 3 cut(s) 3383, 3631, 4549
Bse8I GATNNNNATC 1 cut(s) 3024
BseAI TCCGGA 2 cut(s) 3083, 4510
BseBI CCWGG 3 cut(s) 158, 692, 3390
BseCI ATCGAT 1 cut(s) 2968
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 7 cut(s) 136, 169, 227, 2546, 3497, 3722, 4009
BseJI GATNNNNATC 1 cut(s) 3024
BseLI CCNNNNNNNGG 2 cut(s) 121, 4122
BseMI GCAATG 3 cut(s) 3383, 3631, 4549
BseMII CTCAG 7 cut(s) 409, 484, 2605, 3021, 3329, 3561, 4029
BseNI ACTGG 7 cut(s) 256, 2557, 2752, 3018, 3215, 4204, 4435
BseRI GAGGAG 1 cut(s) 786
BseXI GCAGC 2 cut(s) 385, 3439
BseYI CCCAGC 3 cut(s) 2542, 2690, 4573
Bsh1236I CGCG 1 cut(s) 3410
Bsh1285I CGRYCG 2 cut(s) 4378, 4525
BshFI GGCC 5 cut(s) 84, 255, 2556, 2582, 4528
BshNI GGYRCC 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 2968
BsiEI CGRYCG 2 cut(s) 4378, 4525
BsiHKCI CYCGRG 2 cut(s) 620, 4537
BsiSI CCGG 6 cut(s) 2843, 2915, 2961, 3084, 4511, 4629
BslFI GGGAC 2 cut(s) 3773, 4173
BslI CCNNNNNNNGG 2 cut(s) 121, 4122
BsmAI GTCTC 6 cut(s) 147, 204, 3580, 3601, 4540, 4630
BsmFI GGGAC 2 cut(s) 3773, 4173
BsmI GAATGC 3 cut(s) 283, 3379, 4687
BsnI GGCC 5 cut(s) 84, 255, 2556, 2582, 4528
Bso31I GGTCTC 2 cut(s) 147, 3601
BsoBI CYCGRG 2 cut(s) 620, 4537
Bsp119I TTCGAA 3 cut(s) 3217, 3237, 3423
Bsp13I TCCGGA 2 cut(s) 3083, 4510
BspANI GGCC 5 cut(s) 84, 255, 2556, 2582, 4528
BspCNI CTCAG 7 cut(s) 408, 483, 2604, 3020, 3328, 3560, 4030
BspDI ATCGAT 1 cut(s) 2968
BspEI TCCGGA 2 cut(s) 3083, 4510
BspFNI CGCG 1 cut(s) 3410
BspLI GGNNCC 3 cut(s) 113, 1749, 3147
BspMI ACCTGC 2 cut(s) 183, 2586
BspPI GGATC 6 cut(s) 2676, 3474, 3790, 4379, 4502, 4547
BspT104I TTCGAA 3 cut(s) 3217, 3237, 3423
BspT107I GGYRCC 1 cut(s) 111
BspTI CTTAAG 1 cut(s) 775
BspTNI GGTCTC 2 cut(s) 147, 3601
BsrDI GCAATG 3 cut(s) 3383, 3631, 4549
BsrI ACTGG 7 cut(s) 256, 2557, 2752, 3018, 3215, 4204, 4435
BssECI CCNNGG 1 cut(s) 79
BssSI CACGAG 1 cut(s) 706
Bst2BI CACGAG 1 cut(s) 706
Bst2UI CCWGG 3 cut(s) 158, 692, 3390
Bst4CI ACNGT 7 cut(s) 215, 317, 3081, 3438, 3873, 4523, 4609
BstAFI CTTAAG 1 cut(s) 775
BstAPI GCANNNNNTGC 1 cut(s) 140
BstBI TTCGAA 3 cut(s) 3217, 3237, 3423
BstC8I GCNNGC 8 cut(s) 418, 1117, 1261, 1621, 1693, 2978, 3863, 4305
BstF5I GGATG 7 cut(s) 136, 169, 227, 2546, 3497, 3722, 4009
BstFNI CGCG 1 cut(s) 3410
BstMAI GTCTC 6 cut(s) 147, 204, 3580, 3601, 4540, 4630
BstMCI CGRYCG 2 cut(s) 4378, 4525
BstMWI GCNNNNNNNGC 3 cut(s) 55, 140, 4570
BstNI CCWGG 3 cut(s) 158, 692, 3390
BstNSI RCATGY 1 cut(s) 29
BstSCI CCNGG 4 cut(s) 156, 690, 3388, 4628
BstSFI CTRYAG 2 cut(s) 2885, 3654
BstUI CGCG 1 cut(s) 3410
BstV1I GCAGC 2 cut(s) 385, 3439
BstV2I GAAGAC 1 cut(s) 2784
BstX2I RGATCY 8 cut(s) 294, 466, 541, 2668, 2809, 2953, 3466, 4552
BstYI RGATCY 8 cut(s) 294, 466, 541, 2668, 2809, 2953, 3466, 4552
Bsu15I ATCGAT 1 cut(s) 2968
BsuRI GGCC 5 cut(s) 84, 255, 2556, 2582, 4528
BsuTUI ATCGAT 1 cut(s) 2968
BtsCI GGATG 7 cut(s) 136, 169, 227, 2546, 3497, 3722, 4009
BtsI GCAGTG 2 cut(s) 235, 411
BtsIMutI CAGTG 3 cut(s) 235, 403, 411
BveI ACCTGC 2 cut(s) 183, 2586
Cac8I GCNNGC 8 cut(s) 418, 1117, 1261, 1621, 1693, 2978, 3863, 4305
CaiI CAGNNNCTG 1 cut(s) 3791
Cfr13I GGNCC 1 cut(s) 4393
ClaI ATCGAT 1 cut(s) 2968
CseI GACGC 1 cut(s) 3399
CsiI ACCWGGT 1 cut(s) 156
Csp6I GTAC 6 cut(s) 313, 2643, 2984, 3272, 4059, 4434
CviQI GTAC 6 cut(s) 313, 2643, 2984, 3272, 4059, 4434
DraI TTTAAA 5 cut(s) 684, 936, 1512, 3157, 3531
DriI GACNNNNNGTC 1 cut(s) 3593
EaeI YGGCCR 5 cut(s) 82, 253, 2554, 2580, 4526
Eam1105I GACNNNNNGTC 1 cut(s) 3593
Eco31I GGTCTC 2 cut(s) 147, 3601
Eco32I GATATC 2 cut(s) 1441, 3328
Eco47I GGWCC 1 cut(s) 4393
Eco57I CTGAAG 1 cut(s) 3498
Eco88I CYCGRG 2 cut(s) 620, 4537
EcoRI GAATTC 3 cut(s) 1411, 1483, 3037
EcoRII CCWGG 3 cut(s) 156, 690, 3388
EcoRV GATATC 2 cut(s) 1441, 3328
EcoT22I ATGCAT 1 cut(s) 4666
FaqI GGGAC 2 cut(s) 3773, 4173
FauI CCCGC 1 cut(s) 2969
FbaI TGATCA 1 cut(s) 4719
Fnu4HI GCNGC 2 cut(s) 374, 3453
FokI GGATG 7 cut(s) 143, 176, 234, 2533, 3484, 3709, 3996
Fsp4HI GCNGC 2 cut(s) 374, 3453
FspBI CTAG 6 cut(s) 116, 464, 539, 641, 4050, 4592
GluI GCNGC 2 cut(s) 374, 3453
GsaI CCCAGC 3 cut(s) 2546, 2694, 4577
GsuI CTGGAG 2 cut(s) 3310, 3411
HaeIII GGCC 5 cut(s) 84, 255, 2556, 2582, 4528
HapII CCGG 6 cut(s) 2843, 2915, 2961, 3084, 4511, 4629
HgaI GACGC 1 cut(s) 3399
HincII GTYRAC 1 cut(s) 853
HindII GTYRAC 1 cut(s) 853
HindIII AAGCTT 1 cut(s) 3773
HpaII CCGG 6 cut(s) 2843, 2915, 2961, 3084, 4511, 4629
HphI GGTGA 4 cut(s) 236, 356, 575, 4360
Hpy166II GTNNAC 4 cut(s) 235, 853, 2606, 3916
Hpy8I GTNNAC 4 cut(s) 235, 853, 2606, 3916
HpyCH4III ACNGT 7 cut(s) 215, 317, 3081, 3438, 3873, 4523, 4609
HpyCH4IV ACGT 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 3 cut(s) 55, 140, 4570
HpySE526I ACGT 1 cut(s) 99
Kpn2I TCCGGA 2 cut(s) 3083, 4510
Ksp22I TGATCA 1 cut(s) 4719
LmnI GCTCC 3 cut(s) 492, 756, 3858
Lsp1109I GCAGC 2 cut(s) 385, 3439
MabI ACCWGGT 1 cut(s) 156
MaeI CTAG 6 cut(s) 116, 464, 539, 641, 4050, 4592
MaeII ACGT 1 cut(s) 99
MaeIII GTNAC 5 cut(s) 100, 398, 2428, 3302, 3508
MfeI CAATTG 2 cut(s) 42, 658
MflI RGATCY 8 cut(s) 294, 466, 541, 2668, 2809, 2953, 3466, 4552
MlsI TGGCCA 3 cut(s) 255, 2556, 2582
MluNI TGGCCA 3 cut(s) 255, 2556, 2582
MlyI GAGTC 6 cut(s) 240, 718, 1425, 3301, 3307, 4632
Mox20I TGGCCA 3 cut(s) 255, 2556, 2582
Mph1103I ATGCAT 1 cut(s) 4666
MroI TCCGGA 2 cut(s) 3083, 4510
MroXI GAANNNNTTC 2 cut(s) 2622, 2767
MscI TGGCCA 3 cut(s) 255, 2556, 2582
MslI CAYNNNNRTG 5 cut(s) 30, 90, 276, 3502, 3874
Msp20I TGGCCA 3 cut(s) 255, 2556, 2582
MspCI CTTAAG 1 cut(s) 775
MspI CCGG 6 cut(s) 2843, 2915, 2961, 3084, 4511, 4629
MspR9I CCNGG 4 cut(s) 158, 692, 3390, 4630
MunI CAATTG 2 cut(s) 42, 658
Mva1269I GAATGC 3 cut(s) 283, 3379, 4687
MvaI CCWGG 3 cut(s) 158, 692, 3390
MvnI CGCG 1 cut(s) 3410
MwoI GCNNNNNNNGC 3 cut(s) 55, 140, 4570
NciI CCSGG 1 cut(s) 4630
NlaIV GGNNCC 3 cut(s) 113, 1749, 3147
NmeAIII GCCGAG 1 cut(s) 60
NmuCI GTSAC 2 cut(s) 100, 398
NsiI ATGCAT 1 cut(s) 4666
NspI RCATGY 1 cut(s) 29
NspV TTCGAA 3 cut(s) 3217, 3237, 3423
PaeR7I CTCGAG 1 cut(s) 4537
PcsI WCGNNNNNNNCGW 1 cut(s) 4375
PctI GAATGC 3 cut(s) 283, 3379, 4687
PdmI GAANNNNTTC 2 cut(s) 2622, 2767
PfoI TCCNGGA 1 cut(s) 4628
PkrI GCNGC 2 cut(s) 375, 3454
PleI GAGTC 6 cut(s) 239, 717, 1425, 3300, 3307, 4631
PpsI GAGTC 6 cut(s) 239, 717, 1425, 3300, 3307, 4631
PshBI ATTAAT 1 cut(s) 3089
Psp6I CCWGG 3 cut(s) 156, 690, 3388
PspFI CCCAGC 3 cut(s) 2542, 2690, 4573
PspGI CCWGG 3 cut(s) 156, 690, 3388
PspN4I GGNNCC 3 cut(s) 113, 1749, 3147
PspPI GGNCC 1 cut(s) 4393
PstNI CAGNNNCTG 1 cut(s) 3791
PsuI RGATCY 8 cut(s) 294, 466, 541, 2668, 2809, 2953, 3466, 4552
RsaI GTAC 6 cut(s) 314, 2644, 2985, 3273, 4060, 4435
RsaNI GTAC 6 cut(s) 313, 2643, 2984, 3272, 4059, 4434
RseI CAYNNNNRTG 5 cut(s) 30, 90, 276, 3502, 3874
SatI GCNGC 2 cut(s) 374, 3453
Sau96I GGNCC 1 cut(s) 4393
SchI GAGTC 6 cut(s) 240, 718, 1425, 3301, 3307, 4632
ScrFI CCNGG 4 cut(s) 158, 692, 3390, 4630
SexAI ACCWGGT 1 cut(s) 156
SfcI CTRYAG 2 cut(s) 2885, 3654
Sfr274I CTCGAG 1 cut(s) 4537
SfuI TTCGAA 3 cut(s) 3217, 3237, 3423
SinI GGWCC 1 cut(s) 4393
SlaI CTCGAG 1 cut(s) 4537
SmiMI CAYNNNNRTG 5 cut(s) 30, 90, 276, 3502, 3874
SmlI CTYRAG 5 cut(s) 697, 775, 3969, 4183, 4537
SmoI CTYRAG 5 cut(s) 697, 775, 3969, 4183, 4537
SspI AATATT 1 cut(s) 386
SspMI CTAG 6 cut(s) 116, 464, 539, 641, 4050, 4592
StyD4I CCNGG 4 cut(s) 156, 690, 3388, 4628
TaaI ACNGT 7 cut(s) 215, 317, 3081, 3438, 3873, 4523, 4609
TaiI ACGT 1 cut(s) 102
TaqI TCGA 8 cut(s) 2968, 3018, 3217, 3237, 3423, 3612, 4374, 4538
TaqII GACCGA 1 cut(s) 4392
TatI WGTACW 2 cut(s) 2642, 3271
TscAI CASTG 3 cut(s) 242, 403, 418
TseFI GTSAC 2 cut(s) 100, 398
TseI GCWGC 2 cut(s) 373, 3452
Tsp45I GTSAC 2 cut(s) 100, 398
TspGWI ACGGA 2 cut(s) 119, 1424
TspRI CASTG 3 cut(s) 242, 403, 418
Vha464I CTTAAG 1 cut(s) 775
VpaK11BI GGWCC 1 cut(s) 4393
VspI ATTAAT 1 cut(s) 3089
XbaI TCTAGA 1 cut(s) 538
XceI RCATGY 1 cut(s) 29
XcmI CCANNNNNNNNNTGG 1 cut(s) 3285
XhoI CTCGAG 1 cut(s) 4537
XmnI GAANNNNTTC 2 cut(s) 2622, 2767
XspI CTAG 6 cut(s) 116, 464, 539, 641, 4050, 4592
Zsp2I ATGCAT 1 cut(s) 4666
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.