AT2G02280

F-box protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
600491 .. 601439
949 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G02280.1

Sequence Viewer

Length: 435 bp
ATGAATACTCAAATCCTATCTCAAAAAACTCGTTACTCGGCTTACATTGTGTACAAGACAATATATAGATTTCATGGCTTTAAACACATTGGAGTTGGATTTATTGGACATGGAACTCCCAAAGCCAAAAGGTGGGAAAGAAAGGATCTAGGGAATGATTGGTTGGGTTGTAAAAAAAAATTTAAAGCTTCTAAAAAACAAAAATTCTACAGCAATAAATCTACATTTACAGACAAACCAATCACCCACTTAATAAAACTTGAGGAGGGGGAAGATGGGTGGATGGCGACAGAGTTTGGGGAATTCTTCGCTGAAGGAGGAGGATTATTGGATTGTGATGAAATTGTGTTGAGTGTTATCGATATTGATTATGCTTATTGGAAGTGTGGTTTGATCATTCAAGGAATTGATATCCGCCCTACGAAAAGCCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

144

Amino Acids

16.55

Weight (kDa)

9.17

Isoelectric Point (pI)

33.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 1 - 140 6e-17 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000189)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G80110 AT2G02240 AT2G02250 AT2G02280 AT2G02300 AT2G02310 AT2G02320 AT2G02340 AT2G02350 AT2G02350 AT2G02360
fragaria_vesca FvH4_1g04390 FvH4_4g27460 FvH4_6g01013 FvH4_6g01014 FvH4_6g01020 FvH4_6g01030 FvH4_6g01090 FvH4_6g01090 FvH4_6g01110
malus_domestica MD04G1236300.v1.1 MD04G1237000.v1.1 MD04G1237100.v1.1 MD04G1237300.v1.1 MD04G1237400.v1.1 MD04G1237600.v1.1 MD04G1237700.v1.1 MD04G1239300.v1.1 MD12G1255400.v1.1 MD12G1255500.v1.1 MD12G1255600.v1.1
prunus_persica Prupe.6G356300_v2.0.a1
pyrus_communis pycom04g21010 pycom04g21080 pycom04g21090 pycom12g23410 pycom12g23420 pycom12g23470
rosa_chinensis RchiOBHm_Chr2g0090041 RchiOBHm_Chr2g0105801 RchiOBHm_Chr2g0168101 RchiOBHm_Chr2g0168151 RchiOBHm_Chr3g0448461 RchiOBHm_Chr3g0448471 RchiOBHm_Chr3g0448501 RchiOBHm_Chr3g0448511 RchiOBHm_Chr3g0448521 RchiOBHm_Chr3g0448621 RchiOBHm_Chr3g0450261 RchiOBHm_Chr3g0450281 RchiOBHm_Chr6g0255241
rosa_laevigata RLG00000014851 RLG00000016080 RLG00000017458 RLG00000023974 RLG00000025742 RLG00000025744 RLG00000025883 RLG00000025900 RLG00000025901 RLG00000025903 RLG00000025904
rosa_multiflora Rmu_co8313739.1_g000001 Rmu_co8361343.1_g000001 Rmu_co8363919.1_g000001 Rmu_co8385575.1_g000001 Rmu_co8448943.1_g000001 Rmu_sc0000082.1_g000049 Rmu_sc0002741.1_g000008 Rmu_sc0003116.1_g000039 Rmu_sc0003308.1_g000013 Rmu_sc0005298.1_g000006 Rmu_sc0005298.1_g000008 Rmu_sc0007766.1_g000003 Rmu_sc0011979.1_g000006 Rmu_sc0016252.1_g000001 Rmu_sc0023110.1_g000001 Rmu_sc0023110.1_g000002 Rmu_sc0023110.1_g000003 Rmu_sc0041893.1_g000001
rosa_roxburghii Rroxscaffold_2G00137910 Rroxscaffold_2G00151450 Rroxscaffold_6G00426700 Rroxscaffold_6G00426730 Rroxscaffold_6G00426740 Rroxscaffold_6G00426750 Rroxscaffold_6G00426760 Rroxscaffold_6G00426910 Rroxscaffold_6G00428000 Rroxscaffold_6G00428010
rosa_rugosa Rorug02G0004900 Rorug02G0130400 Rorug02G0130400 Rorug02G0612700 Rorug02G0612900 Rorug02G0613000 Rorug02G0613100 Rorug02G0613100 Rorug02G0614700 Rorug02G0614800 Rorug02G0614900 Rorug02G0626500
rosa_samantha Rh2BG049100 Rh2BG190800 Rh2BG613500 Rh2BG613800 Rh2CG051300 Rh2DG050700 Rh2DG187600 Rh2DG187700 Rh2DG402600 Rh3AG012100 Rh3AG012200 Rh3AG012300 Rh3AG012500 Rh3AG012600 Rh3AG012700 Rh3AG012800 Rh3AG013700 Rh3AG025900 Rh3AG026200 Rh3AG026500 Rh3AG026700 Rh3BG011900 Rh3BG012000 Rh3BG012100 Rh3BG012200 Rh3BG012300 Rh3BG013500 Rh3BG026600 Rh3BG026800 Rh3BG027200 Rh3BG027400 Rh3DG012300 Rh3DG012400 Rh3DG012500 Rh3DG012600 Rh3DG012700 Rh3DG012800 Rh3DG012900 Rh3DG014300 Rh3DG026500 Rh3DG026800 Rh3DG027100 Rh3DG027200 Rh3DG122000 Rh3DG282500 Rh5BG266700 Rh6BG370500 Rh7CG395700
rosa_wichuraiana Rw0G020400 Rw2G004010 Rw2G014220 Rw3G000940 Rw3G000950 Rw3G000960 Rw3G001010 Rw3G002090 Rw3G002100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 132
AciI CCGC 1 cut(s) 415
AclWI GGATC 1 cut(s) 153
AcsI RAATTY 3 cut(s) 179, 203, 302
AcuI CTGAAG 1 cut(s) 333
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 132
AgsI TTSAA 1 cut(s) 401
AjuI GAANNNNNNNTTGG 2 cut(s) 146, 178
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
AlwI GGATC 1 cut(s) 153
ApoI RAATTY 3 cut(s) 179, 203, 302
AsuHPI GGTGA 1 cut(s) 235
BccI CCATC 2 cut(s) 269, 277
BclI TGATCA 1 cut(s) 393
BfaI CTAG 1 cut(s) 149
BfmI CTRYAG 1 cut(s) 208
BpuEI CTTGAG 1 cut(s) 281
Bsa29I ATCGAT 1 cut(s) 360
Bsc4I CCNNNNNNNGG 1 cut(s) 132
BseCI ATCGAT 1 cut(s) 360
BseGI GGATG 1 cut(s) 288
BseLI CCNNNNNNNGG 1 cut(s) 132
BseRI GAGGAG 2 cut(s) 278, 333
BshVI ATCGAT 1 cut(s) 360
BslI CCNNNNNNNGG 1 cut(s) 132
Bsp1407I TGTACA 1 cut(s) 51
Bsp143I GATC 2 cut(s) 145, 393
BspACI CCGC 1 cut(s) 415
BspDI ATCGAT 1 cut(s) 360
BspPI GGATC 1 cut(s) 153
BsrGI TGTACA 1 cut(s) 51
BssMI GATC 2 cut(s) 145, 393
BstAUI TGTACA 1 cut(s) 51
BstF5I GGATG 1 cut(s) 288
BstKTI GATC 2 cut(s) 148, 396
BstMBI GATC 2 cut(s) 145, 393
BstSFI CTRYAG 1 cut(s) 208
BstX2I RGATCY 1 cut(s) 145
BstYI RGATCY 1 cut(s) 145
Bsu15I ATCGAT 1 cut(s) 360
BsuTUI ATCGAT 1 cut(s) 360
BtsCI GGATG 1 cut(s) 288
ClaI ATCGAT 1 cut(s) 360
Csp6I GTAC 1 cut(s) 52
CviAII CATG 2 cut(s) 74, 110
CviJI RGCY 5 cut(s) 41, 78, 125, 188, 429
CviKI_1 RGCY 5 cut(s) 41, 78, 125, 188, 429
CviQI GTAC 1 cut(s) 52
DpnI GATC 2 cut(s) 147, 395
DpnII GATC 2 cut(s) 145, 393
DraI TTTAAA 2 cut(s) 82, 184
EciI GGCGGA 1 cut(s) 404
Eco32I GATATC 1 cut(s) 412
Eco57I CTGAAG 1 cut(s) 333
EcoRI GAATTC 1 cut(s) 302
EcoRV GATATC 1 cut(s) 412
FaeI CATG 2 cut(s) 77, 113
FaiI YATR 6 cut(s) 64, 66, 75, 111, 372, 433
FatI CATG 2 cut(s) 73, 109
FbaI TGATCA 1 cut(s) 393
FokI GGATG 1 cut(s) 295
FspBI CTAG 1 cut(s) 149
Hin1II CATG 2 cut(s) 77, 113
HindIII AAGCTT 1 cut(s) 186
HphI GGTGA 1 cut(s) 235
Hpy166II GTNNAC 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 308
Hsp92II CATG 2 cut(s) 77, 113
Ksp22I TGATCA 1 cut(s) 393
Kzo9I GATC 2 cut(s) 145, 393
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 32
MalI GATC 2 cut(s) 147, 395
MboI GATC 2 cut(s) 145, 393
MboII GAAGA 2 cut(s) 284, 298
MflI RGATCY 1 cut(s) 145
MluCI AATT 5 cut(s) 179, 203, 302, 342, 405
MmeI TCCRAC 1 cut(s) 76
MnlI CCTC 4 cut(s) 256, 259, 311, 314
MseI TTAA 3 cut(s) 81, 183, 251
NdeII GATC 2 cut(s) 145, 393
NlaIII CATG 2 cut(s) 77, 113
NmeAIII GCCGAG 1 cut(s) 17
PflMI CCANNNNNTGG 1 cut(s) 132
PsuI RGATCY 1 cut(s) 145
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
SaqAI TTAA 3 cut(s) 81, 183, 251
Sau3AI GATC 2 cut(s) 145, 393
SetI ASST 2 cut(s) 134, 190
SfcI CTRYAG 1 cut(s) 208
SgeI CNNG 8 cut(s) 42, 49, 67, 86, 122, 161, 272, 413
SmlI CTYRAG 1 cut(s) 260
SmoI CTYRAG 1 cut(s) 260
Sse9I AATT 5 cut(s) 179, 203, 302, 342, 405
SsiI CCGC 1 cut(s) 415
SspMI CTAG 1 cut(s) 149
TaqI TCGA 1 cut(s) 360
TasI AATT 5 cut(s) 179, 203, 302, 342, 405
TatI WGTACW 1 cut(s) 51
Tru1I TTAA 3 cut(s) 81, 183, 251
Tru9I TTAA 3 cut(s) 81, 183, 251
TspDTI ATGAA 3 cut(s) 17, 62, 354
Van91I CCANNNNNTGG 1 cut(s) 132
XapI RAATTY 3 cut(s) 179, 203, 302
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.