pycom15g38270

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
38095108 .. 38095528
421 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g38270.2

Sequence Viewer

Length: 324 bp
ATGATTCGTGATGCACATGGGCGTAAAATGTCAAAATCCTTGGGGAATGTCATTGATCCACTTGATGTGATAAATGGTGTTGAACTTGAAGGTCTACAGAAGAAGCTTTTAGAGGGAAATTTGGATGCCAAGGAAGTAGCTGTCTCGGAAGAAGGGCTTAAGAAGGACTTTCCTAAGGGGATTAGGGAATGTGGTGCAGATGCTCTCCGTTTTGCTCTAGTGTCTTACACTGCTCAGCATGATAAGATATATCTGGATATCAAAAGGGTGGAGGGCTACAAAAGCTGGTGTAATAAATTGTGGAATGTAGTAAGGTTTCTCTGA

Protein Analysis

108

Amino Acids

12.1

Weight (kDa)

8.55

Isoelectric Point (pI)

26.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000332)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G14610 AT1G27160
fragaria_vesca FvH4_5g33250 FvH4_7g01700 FvH4_7g28940 FvH4_7g28940 FvH4_7g28940
malus_domestica MD01G1196000.v1.1 MD03G1000400.v1.1 MD06G1107900.v1.1 MD07G1262800.v1.1 MD15G1255900.v1.1 MD15G1433500.v1.1 MD17G1256800.v1.1
prunus_persica Prupe.1G576900_v2.0.a1 Prupe.1G576900_v2.0.a1 Prupe.2G289400_v2.0.a1 Prupe.2G289400_v2.0.a1
pyrus_communis pycom01g20660 pycom03g00060 pycom07g24190 pycom15g38270 pycom17g25900
rosa_chinensis RchiOBHm_Chr1g0376611 RchiOBHm_Chr2g0151751 RchiOBHm_Chr2g0151761 RchiOBHm_Chr5g0049821 RchiOBHm_Chr5g0066661 RchiOBHm_Chr7g0182401 RchiOBHm_Chr7g0218391 RchiOBHm_Chr7g0218401 RchiOBHm_Chr7g0218411 RchiOBHm_Chr7g0232241 RchiOBHm_Chr7g0232251 RchiOBHm_Chr7g0232281 RchiOBHm_Chr7g0232291 RchiOBHm_Chr7g0232301
rosa_laevigata RLG00000001360 RLG00000001362 RLG00000001368 RLG00000005125 RLG00000005126 RLG00000026593
rosa_multiflora Rmu_co8187388.1_g000001 Rmu_co8244885.1_g000001 Rmu_co8371739.1_g000001 Rmu_co8421977.1_g000001 Rmu_co8457289.1_g000001 Rmu_sc0000239.1_g000041 Rmu_sc0000927.1_g000001 Rmu_sc0000945.1_g000003 Rmu_sc0002042.1_g000017 Rmu_sc0004136.1_g000003 Rmu_sc0005294.1_g000036 Rmu_sc0017871.1_g000001 Rmu_sc0029500.1_g000001 Rmu_sc0037577.1_g000001 Rmu_sc0037577.1_g000002 Rmu_ssc0000034.1_g000001 Rmu_ssc0000115.1_g000001
rosa_roxburghii Rroxscaffold_2G00112130 Rroxscaffold_3G00228490 Rroxscaffold_3G00228520 Rroxscaffold_3G00228530 Rroxscaffold_3G00228620 Rroxscaffold_3G00228650 Rroxscaffold_4G00281940
rosa_rugosa Rorug01G0396800 Rorug01G0396800 Rorug06G0073800 Rorug06G0073900 Rorug06G0447200 Rorug06G0447200 Rorug06G0447300 Rorug06G0447400 Rorug07G0270800 Rorug07G0271800 Rorug07G0271900 Rorug07G0272000 Rorug07G0272200 Rorug07G0272300
rosa_samantha Rh1AG413400 Rh1BG373100 Rh1CG021500 Rh1CG151000 Rh1CG387000 Rh1DG404000 Rh2BG502300 Rh2DG513300 Rh3AG126000 Rh4AG156700 Rh7AG050700 Rh7AG050800 Rh7AG425000 Rh7AG425500 Rh7AG426200 Rh7BG050400 Rh7BG399800 Rh7BG399900 Rh7BG400000 Rh7CG052000 Rh7CG445400 Rh7CG445600 Rh7CG445900 Rh7CG446000 Rh7DG417300
rosa_wichuraiana Rw0G007060 Rw1G036250 Rw1G036280 Rw7G027040 Rw7G035320 Rw7G035350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 94
AclWI GGATC 1 cut(s) 50
AcsI RAATTY 1 cut(s) 118
AflII CTTAAG 1 cut(s) 158
AgsI TTSAA 2 cut(s) 83, 89
AluBI AGCT 3 cut(s) 106, 140, 285
AluI AGCT 3 cut(s) 106, 140, 285
Alw26I GTCTC 1 cut(s) 148
AlwI GGATC 1 cut(s) 50
ApoI RAATTY 1 cut(s) 118
AxyI CCTNAGG 1 cut(s) 174
BcoDI GTCTC 1 cut(s) 148
BfaI CTAG 1 cut(s) 218
BfmI CTRYAG 1 cut(s) 95
BfrI CTTAAG 1 cut(s) 158
BlpI GCTNAGC 1 cut(s) 234
BmsI GCATC 2 cut(s) 115, 190
Bpu1102I GCTNAGC 1 cut(s) 234
BsaJI CCNNGG 2 cut(s) 39, 129
Bse21I CCTNAGG 1 cut(s) 174
BseDI CCNNGG 2 cut(s) 39, 129
BseGI GGATG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 248
BsgI GTGCAG 1 cut(s) 216
BsmAI GTCTC 1 cut(s) 148
Bsp143I GATC 1 cut(s) 55
Bsp1720I GCTNAGC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 247
BspPI GGATC 1 cut(s) 50
BspTI CTTAAG 1 cut(s) 158
BssECI CCNNGG 2 cut(s) 39, 129
BssMI GATC 1 cut(s) 55
BssT1I CCWWGG 2 cut(s) 39, 129
BstAFI CTTAAG 1 cut(s) 158
BstDEI CTNAG 2 cut(s) 174, 234
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 58
BstMAI GTCTC 1 cut(s) 148
BstMBI GATC 1 cut(s) 55
BstMWI GCNNNNNNNGC 1 cut(s) 282
BstSFI CTRYAG 1 cut(s) 95
Bsu36I CCTNAGG 1 cut(s) 174
BtsCI GGATG 1 cut(s) 130
BtsI GCAGTG 1 cut(s) 228
BtsIMutI CAGTG 1 cut(s) 228
CviAII CATG 2 cut(s) 17, 239
CviJI RGCY 5 cut(s) 106, 140, 157, 276, 285
CviKI_1 RGCY 5 cut(s) 106, 140, 157, 276, 285
DdeI CTNAG 2 cut(s) 174, 234
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
Eco130I CCWWGG 2 cut(s) 39, 129
Eco32I GATATC 1 cut(s) 259
Eco81I CCTNAGG 1 cut(s) 174
EcoRV GATATC 1 cut(s) 259
EcoT14I CCWWGG 2 cut(s) 39, 129
ErhI CCWWGG 2 cut(s) 39, 129
FaeI CATG 2 cut(s) 20, 242
FaiI YATR 3 cut(s) 18, 240, 250
FalI AAGNNNNNCTT 4 cut(s) 141, 173, 152, 184
FatI CATG 2 cut(s) 16, 238
FblI GTMKAC 1 cut(s) 94
FokI GGATG 1 cut(s) 137
FspBI CTAG 1 cut(s) 218
Hin1II CATG 2 cut(s) 20, 242
HindIII AAGCTT 1 cut(s) 104
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 148, 323
Hpy188III TCNNGA 2 cut(s) 8, 254
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 3 cut(s) 83, 146, 157
HpyCH4V TGCA 2 cut(s) 14, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 282
HpyF3I CTNAG 2 cut(s) 174, 234
Hsp92II CATG 2 cut(s) 20, 242
Kzo9I GATC 1 cut(s) 55
LpnPI CCDG 2 cut(s) 239, 271
LweI GCATC 2 cut(s) 115, 190
MaeI CTAG 1 cut(s) 218
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 2 cut(s) 112, 161
MluCI AATT 2 cut(s) 118, 296
MnlI CCTC 2 cut(s) 106, 265
MseI TTAA 1 cut(s) 159
MspCI CTTAAG 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 282
NdeII GATC 1 cut(s) 55
NlaIII CATG 2 cut(s) 20, 242
PfeI GAWTC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 159
Sau3AI GATC 1 cut(s) 55
SetI ASST 5 cut(s) 94, 108, 142, 287, 317
SfaNI GCATC 2 cut(s) 115, 190
SfcI CTRYAG 1 cut(s) 95
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 2 cut(s) 118, 296
SspMI CTAG 1 cut(s) 218
StyI CCWWGG 2 cut(s) 39, 129
TasI AATT 2 cut(s) 118, 296
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 235
TspGWI ACGGA 1 cut(s) 197
TspRI CASTG 1 cut(s) 235
Vha464I CTTAAG 1 cut(s) 158
XapI RAATTY 1 cut(s) 118
XmiI GTMKAC 1 cut(s) 94
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.