RchiOBHm_Chr1g0353481

Belongs to the short-chain dehydrogenases reductases (SDR) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000170
Physical Location & Seq
Forward (+)
46689581 .. 46689883
303 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57911

Sequence Viewer

Length: 303 bp
ATGCAGGAAGCAGGACATATTGATTTCAAAAAGTTGTTGACTGAAACTTATGAGTTAACAGAAGAATGCTTGCAAATCAATTACTATGGTGCTAAAAGAACATCTGAAGCCCTTATTCCACTCCTTCAGCGATCTGATTCACCAAGAATCGTTAATGTTTCATCCTCTATGGGGAAGTTAGAGAACATACTAGGTGATCGGGTGAAAGTACTTCTTAGTACTGATGTCGAGAACCTAAGCAAAGAGAGTGTAGATGAAGTATTGACAGAGTTTCTAATCGACCTCAAGGAGAGTTTACTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

100

Amino Acids

11.32

Weight (kDa)

4.64

Isoelectric Point (pI)

55.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000170)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G01800 AT1G01800 AT2G24190 AT2G24190 AT3G61220 AT3G61220 AT3G61220
fragaria_vesca FvH4_7g13591 FvH4_7g13601 FvH4_7g13602 FvH4_7g13603 FvH4_7g13603 FvH4_7g13603 FvH4_7g13620
malus_domestica MD01G1052500.v1.1 MD01G1052600.v1.1 MD01G1052700.v1.1 MD01G1052800.v1.1 MD01G1053000.v1.1 MD01G1053100.v1.1 MD01G1053200.v1.1 MD01G1053300.v1.1 MD04G1099300.v1.1 MD04G1099400.v1.1 MD04G1099500.v1.1 MD07G1064800.v1.1 MD07G1142200.v1.1 MD07G1142300.v1.1
prunus_persica Prupe.1G171500_v2.0.a1 Prupe.1G171600_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160400_v2.0.a1 Prupe.2G160500_v2.0.a1 Prupe.2G160600_v2.0.a1 Prupe.2G160700_v2.0.a1 Prupe.2G160700_v2.0.a1 Prupe.2G160800_v2.0.a1 Prupe.2G160800_v2.0.a1 Prupe.2G160900_v2.0.a1 Prupe.2G161000_v2.0.a1 Prupe.2G161100_v2.0.a1 Prupe.2G161100_v2.0.a1 Prupe.2G161200_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161400_v2.0.a1 Prupe.2G161500_v2.0.a1 Prupe.2G161600_v2.0.a1 Prupe.2G161600_v2.0.a1 Prupe.2G161800_v2.0.a1 Prupe.2G161900_v2.0.a1 Prupe.2G161900_v2.0.a1 Prupe.2G162200_v2.0.a1 Prupe.2G162300_v2.0.a1 Prupe.2G162300_v2.0.a1 Prupe.4G240700_v2.0.a1 Prupe.4G240800_v2.0.a1
pyrus_communis pycom01g07820 pycom01g07840 pycom01g07850 pycom01g07860 pycom01g07880 pycom01g07900 pycom04g09450 pycom04g09460 pycom07g01290 pycom07g12490 pycom07g12510 pycom07g12570 pycom07g14080
rosa_chinensis RchiOBHm_Chr1g0353391 RchiOBHm_Chr1g0353401 RchiOBHm_Chr1g0353411 RchiOBHm_Chr1g0353421 RchiOBHm_Chr1g0353431 RchiOBHm_Chr1g0353481 RchiOBHm_Chr1g0353511 RchiOBHm_Chr1g0353531 RchiOBHm_Chr1g0353541 RchiOBHm_Chr1g0353571 RchiOBHm_Chr1g0353581 RchiOBHm_Chr1g0353621 RchiOBHm_Chr1g0353661 RchiOBHm_Chr7g0224711 RchiOBHm_Chr7g0224731 RchiOBHm_Chr7g0224751
rosa_laevigata RLG00000001859 RLG00000001863 RLG00000028244 RLG00000028267 RLG00000028269 RLG00000028270 RLG00000028272
rosa_multiflora Rmu_co8260681.1_g000001 Rmu_co8305447.1_g000001 Rmu_co8330951.1_g000001 Rmu_co8341853.1_g000001 Rmu_sc0000144.1_g000019 Rmu_sc0000144.1_g000020 Rmu_sc0000144.1_g000026 Rmu_sc0000687.1_g000012 Rmu_sc0000687.1_g000018 Rmu_sc0000687.1_g000019 Rmu_sc0000687.1_g000020 Rmu_sc0000687.1_g000026 Rmu_sc0001207.1_g000001 Rmu_sc0001207.1_g000012 Rmu_sc0005914.1_g000002 Rmu_sc0005914.1_g000005 Rmu_sc0005914.1_g000007 Rmu_sc0005947.1_g000025 Rmu_sc0007658.1_g000005 Rmu_sc0011028.1_g000012 Rmu_sc0011028.1_g000013 Rmu_sc0026118.1_g000001 Rmu_sc0026975.1_g000001 Rmu_sc0027167.1_g000001 Rmu_sc0042792.1_g000001
rosa_roxburghii Rroxscaffold_3G00234470 Rroxscaffold_4G00301760 Rroxscaffold_4G00301810 Rroxscaffold_4G00301820 Rroxscaffold_4G00301830 Rroxscaffold_4G00301840 Rroxscaffold_4G00301860 Rroxscaffold_4G00301870
rosa_rugosa Rorug01G0235700 Rorug01G0236300 Rorug01G0236600 Rorug01G0236800 Rorug07G0225000.1 Rorug07G0225100
rosa_samantha Rh1AG247900 Rh1AG248000 Rh1AG248400 Rh1AG248500 Rh1AG248600 Rh1AG248800 Rh1AG249000 Rh1AG249100 Rh1BG217700 Rh1BG218000 Rh1BG218400 Rh1BG218600 Rh1BG218800 Rh1BG218900 Rh1BG219200 Rh1DG244000 Rh1DG244300 Rh1DG244800 Rh1DG245000 Rh1DG245200 Rh1DG245300 Rh1DG245600 Rh1DG246200 Rh7BG361100 Rh7CG396500 Rh7CG396700 Rh7DG371200
rosa_wichuraiana Rw1G021600 Rw1G021610 Rw1G021620 Rw1G021640 Rw1G021650 Rw1G021660 Rw1G021680 Rw1G021710 Rw1G021900 Rw7G031330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 110, 126
AfaI GTAC 2 cut(s) 210, 220
AfiI CCNNNNNNNGG 1 cut(s) 171
AgsI TTSAA 1 cut(s) 28
AsuHPI GGTGA 3 cut(s) 132, 206, 214
BfaI CTAG 1 cut(s) 191
BmcAI AGTACT 2 cut(s) 210, 220
Bpu10I CCTNAGC 1 cut(s) 236
BpuEI CTTGAG 1 cut(s) 269
Bsc4I CCNNNNNNNGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 161
BseLI CCNNNNNNNGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 171
BsmI GAATGC 1 cut(s) 71
Bsp143I GATC 2 cut(s) 131, 196
BssMI GATC 2 cut(s) 131, 196
BstC8I GCNNGC 1 cut(s) 71
BstDEI CTNAG 2 cut(s) 215, 236
BstF5I GGATG 1 cut(s) 161
BstKTI GATC 2 cut(s) 134, 199
BstMBI GATC 2 cut(s) 131, 196
BtsCI GGATG 1 cut(s) 161
Cac8I GCNNGC 1 cut(s) 71
Csp6I GTAC 2 cut(s) 209, 219
CviJI RGCY 1 cut(s) 110
CviKI_1 RGCY 1 cut(s) 110
CviQI GTAC 2 cut(s) 209, 219
DdeI CTNAG 2 cut(s) 215, 236
DpnI GATC 2 cut(s) 133, 198
DpnII GATC 2 cut(s) 131, 196
Eco57I CTGAAG 2 cut(s) 110, 126
FaiI YATR 5 cut(s) 18, 51, 87, 170, 188
FalI AAGNNNNNCTT 2 cut(s) 198, 230
FokI GGATG 1 cut(s) 148
FspBI CTAG 1 cut(s) 191
HincII GTYRAC 2 cut(s) 39, 57
HindII GTYRAC 2 cut(s) 39, 57
HinfI GANTC 2 cut(s) 137, 147
HpaI GTTAAC 1 cut(s) 57
HphI GGTGA 3 cut(s) 132, 206, 214
Hpy166II GTNNAC 3 cut(s) 39, 57, 296
Hpy188I TCNGA 2 cut(s) 106, 136
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 3 cut(s) 39, 57, 296
HpyAV CCTTC 1 cut(s) 134
HpyCH4V TGCA 2 cut(s) 4, 73
HpyF3I CTNAG 2 cut(s) 215, 236
KspAI GTTAAC 1 cut(s) 57
Kzo9I GATC 2 cut(s) 131, 196
MaeI CTAG 1 cut(s) 191
MalI GATC 2 cut(s) 133, 198
MboI GATC 2 cut(s) 131, 196
MboII GAAGA 1 cut(s) 74
MluCI AATT 1 cut(s) 79
MnlI CCTC 2 cut(s) 175, 293
MseI TTAA 3 cut(s) 56, 153, 301
Mva1269I GAATGC 1 cut(s) 71
NdeII GATC 2 cut(s) 131, 196
PctI GAATGC 1 cut(s) 71
PfeI GAWTC 2 cut(s) 137, 147
RsaI GTAC 2 cut(s) 210, 220
RsaNI GTAC 2 cut(s) 209, 219
SaqAI TTAA 3 cut(s) 56, 153, 301
Sau3AI GATC 2 cut(s) 131, 196
ScaI AGTACT 2 cut(s) 210, 220
SetI ASST 3 cut(s) 196, 237, 285
SgeI CNNG 8 cut(s) 17, 24, 82, 156, 203, 212, 241, 298
SmlI CTYRAG 1 cut(s) 284
SmoI CTYRAG 1 cut(s) 284
Sse9I AATT 1 cut(s) 79
SspMI CTAG 1 cut(s) 191
TaqI TCGA 2 cut(s) 228, 279
TasI AATT 1 cut(s) 79
TatI WGTACW 2 cut(s) 208, 218
TfiI GAWTC 2 cut(s) 137, 147
Tru1I TTAA 3 cut(s) 56, 153, 301
Tru9I TTAA 3 cut(s) 56, 153, 301
TspDTI ATGAA 2 cut(s) 150, 270
XspI CTAG 1 cut(s) 191
ZrmI AGTACT 2 cut(s) 210, 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.