Rmu_sc0026118.1_g000001

Belongs to the short-chain dehydrogenases reductases (SDR) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026118.1
OG0000170
Physical Location & Seq
Reverse (-)
2 .. 1130
1129 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026118.1_g000001.1.cds

Sequence Viewer

Length: 512 bp
atggcagaatcaaccaagaggtatgcagttgtgacaggatcaaacaaaggaatcggattcgaaagtgtaaggcagttggcctcaaagggaatcactgtggtcttaactgctagagatgagaagaggggccttgaagctgttgagaaacttaaagagtctggcctctcaggccaagttgtttttcaccaacttgatgtggctgaccctgctagtattacttctctggcactattcatcaaaactcagtttggaaaactcgatattttggttaacaatgcagggattgtaggagctatagttgataatactgatggttttaaagctgcagttgcagcagttgcatctggtggtgaaccaggacagattgattggaaaaagctgctgactgaaacttacgagttaagagaagaatgcttgcaaattaattattatggtgctaagagaacagctgaagcactaattccactcctccagctatctgattcaccaagaattgttaatgtttcatcctc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

171

Amino Acids

18.27

Weight (kDa)

5.9

Isoelectric Point (pI)

29.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000170)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G01800 AT1G01800 AT2G24190 AT2G24190 AT3G61220 AT3G61220 AT3G61220
fragaria_vesca FvH4_7g13591 FvH4_7g13601 FvH4_7g13602 FvH4_7g13603 FvH4_7g13603 FvH4_7g13603 FvH4_7g13620
malus_domestica MD01G1052500.v1.1 MD01G1052600.v1.1 MD01G1052700.v1.1 MD01G1052800.v1.1 MD01G1053000.v1.1 MD01G1053100.v1.1 MD01G1053200.v1.1 MD01G1053300.v1.1 MD04G1099300.v1.1 MD04G1099400.v1.1 MD04G1099500.v1.1 MD07G1064800.v1.1 MD07G1142200.v1.1 MD07G1142300.v1.1
prunus_persica Prupe.1G171500_v2.0.a1 Prupe.1G171600_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160400_v2.0.a1 Prupe.2G160500_v2.0.a1 Prupe.2G160600_v2.0.a1 Prupe.2G160700_v2.0.a1 Prupe.2G160700_v2.0.a1 Prupe.2G160800_v2.0.a1 Prupe.2G160800_v2.0.a1 Prupe.2G160900_v2.0.a1 Prupe.2G161000_v2.0.a1 Prupe.2G161100_v2.0.a1 Prupe.2G161100_v2.0.a1 Prupe.2G161200_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161400_v2.0.a1 Prupe.2G161500_v2.0.a1 Prupe.2G161600_v2.0.a1 Prupe.2G161600_v2.0.a1 Prupe.2G161800_v2.0.a1 Prupe.2G161900_v2.0.a1 Prupe.2G161900_v2.0.a1 Prupe.2G162200_v2.0.a1 Prupe.2G162300_v2.0.a1 Prupe.2G162300_v2.0.a1 Prupe.4G240700_v2.0.a1 Prupe.4G240800_v2.0.a1
pyrus_communis pycom01g07820 pycom01g07840 pycom01g07850 pycom01g07860 pycom01g07880 pycom01g07900 pycom04g09450 pycom04g09460 pycom07g01290 pycom07g12490 pycom07g12510 pycom07g12570 pycom07g14080
rosa_chinensis RchiOBHm_Chr1g0353391 RchiOBHm_Chr1g0353401 RchiOBHm_Chr1g0353411 RchiOBHm_Chr1g0353421 RchiOBHm_Chr1g0353431 RchiOBHm_Chr1g0353481 RchiOBHm_Chr1g0353511 RchiOBHm_Chr1g0353531 RchiOBHm_Chr1g0353541 RchiOBHm_Chr1g0353571 RchiOBHm_Chr1g0353581 RchiOBHm_Chr1g0353621 RchiOBHm_Chr1g0353661 RchiOBHm_Chr7g0224711 RchiOBHm_Chr7g0224731 RchiOBHm_Chr7g0224751
rosa_laevigata RLG00000001859 RLG00000001863 RLG00000028244 RLG00000028267 RLG00000028269 RLG00000028270 RLG00000028272
rosa_multiflora Rmu_co8260681.1_g000001 Rmu_co8305447.1_g000001 Rmu_co8330951.1_g000001 Rmu_co8341853.1_g000001 Rmu_sc0000144.1_g000019 Rmu_sc0000144.1_g000020 Rmu_sc0000144.1_g000026 Rmu_sc0000687.1_g000012 Rmu_sc0000687.1_g000018 Rmu_sc0000687.1_g000019 Rmu_sc0000687.1_g000020 Rmu_sc0000687.1_g000026 Rmu_sc0001207.1_g000001 Rmu_sc0001207.1_g000012 Rmu_sc0005914.1_g000002 Rmu_sc0005914.1_g000005 Rmu_sc0005914.1_g000007 Rmu_sc0005947.1_g000025 Rmu_sc0007658.1_g000005 Rmu_sc0011028.1_g000012 Rmu_sc0011028.1_g000013 Rmu_sc0026118.1_g000001 Rmu_sc0026975.1_g000001 Rmu_sc0027167.1_g000001 Rmu_sc0042792.1_g000001
rosa_roxburghii Rroxscaffold_3G00234470 Rroxscaffold_4G00301760 Rroxscaffold_4G00301810 Rroxscaffold_4G00301820 Rroxscaffold_4G00301830 Rroxscaffold_4G00301840 Rroxscaffold_4G00301860 Rroxscaffold_4G00301870
rosa_rugosa Rorug01G0235700 Rorug01G0236300 Rorug01G0236600 Rorug01G0236800 Rorug07G0225000.1 Rorug07G0225100
rosa_samantha Rh1AG247900 Rh1AG248000 Rh1AG248400 Rh1AG248500 Rh1AG248600 Rh1AG248800 Rh1AG249000 Rh1AG249100 Rh1BG217700 Rh1BG218000 Rh1BG218400 Rh1BG218600 Rh1BG218800 Rh1BG218900 Rh1BG219200 Rh1DG244000 Rh1DG244300 Rh1DG244800 Rh1DG245000 Rh1DG245200 Rh1DG245300 Rh1DG245600 Rh1DG246200 Rh7BG361100 Rh7CG396500 Rh7CG396700 Rh7DG371200
rosa_wichuraiana Rw1G021600 Rw1G021610 Rw1G021620 Rw1G021640 Rw1G021650 Rw1G021660 Rw1G021680 Rw1G021710 Rw1G021900 Rw7G031330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 471
AgsI TTSAA 1 cut(s) 134
AjnI CCWGG 1 cut(s) 355
AjuI GAANNNNNNNTTGG 2 cut(s) 165, 197
AluBI AGCT 6 cut(s) 137, 293, 323, 379, 449, 475
AluI AGCT 6 cut(s) 137, 293, 323, 379, 449, 475
AlwI GGATC 1 cut(s) 46
AoxI GGCC 4 cut(s) 78, 127, 160, 169
ApeKI GCWGC 3 cut(s) 323, 332, 379
AseI ATTAAT 1 cut(s) 423
AspS9I GGNCC 1 cut(s) 127
AsuHPI GGTGA 3 cut(s) 176, 362, 477
AsuII TTCGAA 1 cut(s) 60
BbvI GCAGC 3 cut(s) 310, 344, 366
BccI CCATC 1 cut(s) 305
BciT130I CCWGG 1 cut(s) 357
BfaI CTAG 2 cut(s) 111, 210
BfmI CTRYAG 2 cut(s) 294, 324
BglI GCCNNNNNGGC 1 cut(s) 168
BisI GCNGC 3 cut(s) 324, 333, 380
BlsI GCNGC 3 cut(s) 325, 334, 381
Bme1390I CCNGG 1 cut(s) 357
BmgT120I GGNCC 1 cut(s) 127
BmiI GGNNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 357
BmsI GCATC 1 cut(s) 350
BpmI CTGGAG 1 cut(s) 455
Bpu14I TTCGAA 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 282, 312
BseBI CCWGG 1 cut(s) 357
BseGI GGATG 1 cut(s) 506
BseMII CTCAG 2 cut(s) 180, 257
BseRI GAGGAG 1 cut(s) 458
BseXI GCAGC 3 cut(s) 310, 344, 366
BshFI GGCC 4 cut(s) 80, 129, 162, 171
BsmI GAATGC 1 cut(s) 416
BsnI GGCC 4 cut(s) 80, 129, 162, 171
Bsp119I TTCGAA 1 cut(s) 60
Bsp143I GATC 1 cut(s) 38
BspANI GGCC 4 cut(s) 80, 129, 162, 171
BspCNI CTCAG 2 cut(s) 179, 256
BspLI GGNNCC 1 cut(s) 128
BspMAI CTGCAG 1 cut(s) 328
BspPI GGATC 1 cut(s) 46
BspT104I TTCGAA 1 cut(s) 60
BssMI GATC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 357
Bst4CI ACNGT 1 cut(s) 97
Bst6I CTCTTC 1 cut(s) 116
BstAPI GCANNNNNTGC 1 cut(s) 338
BstBI TTCGAA 1 cut(s) 60
BstC8I GCNNGC 1 cut(s) 416
BstDEI CTNAG 3 cut(s) 166, 243, 438
BstF5I GGATG 1 cut(s) 506
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstMWI GCNNNNNNNGC 5 cut(s) 168, 206, 329, 332, 338
BstNI CCWGG 1 cut(s) 357
BstSCI CCNGG 1 cut(s) 355
BstSFI CTRYAG 2 cut(s) 294, 324
BstV1I GCAGC 3 cut(s) 310, 344, 366
BsuRI GGCC 4 cut(s) 80, 129, 162, 171
BtsCI GGATG 1 cut(s) 506
BtsIMutI CAGTG 1 cut(s) 93
Cac8I GCNNGC 1 cut(s) 416
Cfr13I GGNCC 1 cut(s) 127
DdeI CTNAG 3 cut(s) 166, 243, 438
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
DraI TTTAAA 1 cut(s) 319
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
Eco57I CTGAAG 1 cut(s) 471
EcoO109I RGGNCCY 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 355
FaiI YATR 3 cut(s) 24, 296, 432
Fnu4HI GCNGC 3 cut(s) 324, 333, 380
FokI GGATG 1 cut(s) 493
Fsp4HI GCNGC 3 cut(s) 324, 333, 380
FspBI CTAG 2 cut(s) 111, 210
GluI GCNGC 3 cut(s) 324, 333, 380
GsuI CTGGAG 1 cut(s) 455
HaeIII GGCC 4 cut(s) 80, 129, 162, 171
HincII GTYRAC 1 cut(s) 271
HindII GTYRAC 1 cut(s) 271
HinfI GANTC 6 cut(s) 8, 51, 57, 90, 155, 482
HpaI GTTAAC 1 cut(s) 271
HphI GGTGA 3 cut(s) 176, 362, 477
Hpy166II GTNNAC 2 cut(s) 271, 353
Hpy188I TCNGA 2 cut(s) 56, 481
Hpy8I GTNNAC 2 cut(s) 271, 353
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4V TGCA 6 cut(s) 26, 278, 326, 332, 341, 418
HpyF10VI GCNNNNNNNGC 5 cut(s) 168, 206, 329, 332, 338
HpyF3I CTNAG 3 cut(s) 166, 243, 438
KspAI GTTAAC 1 cut(s) 271
Kzo9I GATC 1 cut(s) 38
LmnI GCTCC 1 cut(s) 290
Lsp1109I GCAGC 3 cut(s) 310, 344, 366
LweI GCATC 1 cut(s) 350
MaeI CTAG 2 cut(s) 111, 210
MaeIII GTNAC 1 cut(s) 31
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 2 cut(s) 133, 419
MluCI AATT 4 cut(s) 420, 424, 459, 492
MlyI GAGTC 1 cut(s) 164
MnlI CCTC 5 cut(s) 12, 91, 117, 173, 479
MseI TTAA 7 cut(s) 104, 150, 270, 318, 401, 423, 498
MspA1I CMGCKG 1 cut(s) 449
MspR9I CCNGG 1 cut(s) 357
Mva1269I GAATGC 1 cut(s) 416
MvaI CCWGG 1 cut(s) 357
MwoI GCNNNNNNNGC 5 cut(s) 168, 206, 329, 332, 338
NdeII GATC 1 cut(s) 38
NlaIV GGNNCC 1 cut(s) 128
NmuCI GTSAC 1 cut(s) 31
NspV TTCGAA 1 cut(s) 60
PctI GAATGC 1 cut(s) 416
PfeI GAWTC 5 cut(s) 8, 51, 57, 90, 482
PkrI GCNGC 3 cut(s) 325, 334, 381
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
PshBI ATTAAT 1 cut(s) 423
Psp6I CCWGG 1 cut(s) 355
PspGI CCWGG 1 cut(s) 355
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 127
PstI CTGCAG 1 cut(s) 328
PvuII CAGCTG 1 cut(s) 449
SaqAI TTAA 7 cut(s) 104, 150, 270, 318, 401, 423, 498
SatI GCNGC 3 cut(s) 324, 333, 380
Sau3AI GATC 1 cut(s) 38
Sau96I GGNCC 1 cut(s) 127
SchI GAGTC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 357
SetI ASST 7 cut(s) 23, 139, 295, 325, 381, 451, 477
SfaNI GCATC 1 cut(s) 350
SfcI CTRYAG 2 cut(s) 294, 324
SfiI GGCCNNNNNGGCC 1 cut(s) 168
SfuI TTCGAA 1 cut(s) 60
Sse9I AATT 4 cut(s) 420, 424, 459, 492
SspMI CTAG 2 cut(s) 111, 210
StyD4I CCNGG 1 cut(s) 355
TaaI ACNGT 1 cut(s) 97
TaqI TCGA 2 cut(s) 60, 258
TasI AATT 4 cut(s) 420, 424, 459, 492
TfiI GAWTC 5 cut(s) 8, 51, 57, 90, 482
Tru1I TTAA 7 cut(s) 104, 150, 270, 318, 401, 423, 498
Tru9I TTAA 7 cut(s) 104, 150, 270, 318, 401, 423, 498
TscAI CASTG 1 cut(s) 100
TseFI GTSAC 1 cut(s) 31
TseI GCWGC 3 cut(s) 323, 332, 379
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 2 cut(s) 223, 495
TspRI CASTG 1 cut(s) 100
VspI ATTAAT 1 cut(s) 423
XspI CTAG 2 cut(s) 111, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.