Rmu_sc0042792.1_g000001

Belongs to the short-chain dehydrogenases reductases (SDR) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042792.1
Physical Location & Seq
Reverse (-)
2 .. 561
560 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042792.1_g000001.1.cds

Sequence Viewer

Length: 291 bp
atggcagaatcaactaagaggtatgcagttgtgacaggatcaaacaaaggaatcggattcgaaactgtaaggcagttggcctcaaagggaatcacagtggtgttaactgctagagatgagaagaggggccttgaagctgttgagaaactgaaagagtctggcctctcaggccaggtagtctttcaccaacttgatgtggctgacccagctagtattgcttctctggcacaattcatcaaaacccagatcgggaaactcgatattttggtgaacaatgcaggaattggtgga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.21

Weight (kDa)

9.1

Isoelectric Point (pI)

18.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000170)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G01800 AT1G01800 AT2G24190 AT2G24190 AT3G61220 AT3G61220 AT3G61220
fragaria_vesca FvH4_7g13591 FvH4_7g13601 FvH4_7g13602 FvH4_7g13603 FvH4_7g13603 FvH4_7g13603 FvH4_7g13620
malus_domestica MD01G1052500.v1.1 MD01G1052600.v1.1 MD01G1052700.v1.1 MD01G1052800.v1.1 MD01G1053000.v1.1 MD01G1053100.v1.1 MD01G1053200.v1.1 MD01G1053300.v1.1 MD04G1099300.v1.1 MD04G1099400.v1.1 MD04G1099500.v1.1 MD07G1064800.v1.1 MD07G1142200.v1.1 MD07G1142300.v1.1
prunus_persica Prupe.1G171500_v2.0.a1 Prupe.1G171600_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160100_v2.0.a1 Prupe.2G160400_v2.0.a1 Prupe.2G160500_v2.0.a1 Prupe.2G160600_v2.0.a1 Prupe.2G160700_v2.0.a1 Prupe.2G160700_v2.0.a1 Prupe.2G160800_v2.0.a1 Prupe.2G160800_v2.0.a1 Prupe.2G160900_v2.0.a1 Prupe.2G161000_v2.0.a1 Prupe.2G161100_v2.0.a1 Prupe.2G161100_v2.0.a1 Prupe.2G161200_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161300_v2.0.a1 Prupe.2G161400_v2.0.a1 Prupe.2G161500_v2.0.a1 Prupe.2G161600_v2.0.a1 Prupe.2G161600_v2.0.a1 Prupe.2G161800_v2.0.a1 Prupe.2G161900_v2.0.a1 Prupe.2G161900_v2.0.a1 Prupe.2G162200_v2.0.a1 Prupe.2G162300_v2.0.a1 Prupe.2G162300_v2.0.a1 Prupe.4G240700_v2.0.a1 Prupe.4G240800_v2.0.a1
pyrus_communis pycom01g07820 pycom01g07840 pycom01g07850 pycom01g07860 pycom01g07880 pycom01g07900 pycom04g09450 pycom04g09460 pycom07g01290 pycom07g12490 pycom07g12510 pycom07g12570 pycom07g14080
rosa_chinensis RchiOBHm_Chr1g0353391 RchiOBHm_Chr1g0353401 RchiOBHm_Chr1g0353411 RchiOBHm_Chr1g0353421 RchiOBHm_Chr1g0353431 RchiOBHm_Chr1g0353481 RchiOBHm_Chr1g0353511 RchiOBHm_Chr1g0353531 RchiOBHm_Chr1g0353541 RchiOBHm_Chr1g0353571 RchiOBHm_Chr1g0353581 RchiOBHm_Chr1g0353621 RchiOBHm_Chr1g0353661 RchiOBHm_Chr7g0224711 RchiOBHm_Chr7g0224731 RchiOBHm_Chr7g0224751
rosa_laevigata RLG00000001859 RLG00000001863 RLG00000028244 RLG00000028267 RLG00000028269 RLG00000028270 RLG00000028272
rosa_multiflora Rmu_co8260681.1_g000001 Rmu_co8305447.1_g000001 Rmu_co8330951.1_g000001 Rmu_co8341853.1_g000001 Rmu_sc0000144.1_g000019 Rmu_sc0000144.1_g000020 Rmu_sc0000144.1_g000026 Rmu_sc0000687.1_g000012 Rmu_sc0000687.1_g000018 Rmu_sc0000687.1_g000019 Rmu_sc0000687.1_g000020 Rmu_sc0000687.1_g000026 Rmu_sc0001207.1_g000001 Rmu_sc0001207.1_g000012 Rmu_sc0005914.1_g000002 Rmu_sc0005914.1_g000005 Rmu_sc0005914.1_g000007 Rmu_sc0005947.1_g000025 Rmu_sc0007658.1_g000005 Rmu_sc0011028.1_g000012 Rmu_sc0011028.1_g000013 Rmu_sc0026118.1_g000001 Rmu_sc0026975.1_g000001 Rmu_sc0027167.1_g000001 Rmu_sc0042792.1_g000001
rosa_roxburghii Rroxscaffold_3G00234470 Rroxscaffold_4G00301760 Rroxscaffold_4G00301810 Rroxscaffold_4G00301820 Rroxscaffold_4G00301830 Rroxscaffold_4G00301840 Rroxscaffold_4G00301860 Rroxscaffold_4G00301870
rosa_rugosa Rorug01G0235700 Rorug01G0236300 Rorug01G0236600 Rorug01G0236800 Rorug07G0225000.1 Rorug07G0225100
rosa_samantha Rh1AG247900 Rh1AG248000 Rh1AG248400 Rh1AG248500 Rh1AG248600 Rh1AG248800 Rh1AG249000 Rh1AG249100 Rh1BG217700 Rh1BG218000 Rh1BG218400 Rh1BG218600 Rh1BG218800 Rh1BG218900 Rh1BG219200 Rh1DG244000 Rh1DG244300 Rh1DG244800 Rh1DG245000 Rh1DG245200 Rh1DG245300 Rh1DG245600 Rh1DG246200 Rh7BG361100 Rh7CG396500 Rh7CG396700 Rh7DG371200
rosa_wichuraiana Rw1G021600 Rw1G021610 Rw1G021620 Rw1G021640 Rw1G021650 Rw1G021660 Rw1G021680 Rw1G021710 Rw1G021900 Rw7G031330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 46
AfiI CCNNNNNNNGG 1 cut(s) 249
AgsI TTSAA 1 cut(s) 134
AjnI CCWGG 1 cut(s) 171
AleI CACNNNNGTG 1 cut(s) 98
AluBI AGCT 2 cut(s) 137, 209
AluI AGCT 2 cut(s) 137, 209
AlwI GGATC 1 cut(s) 46
AoxI GGCC 4 cut(s) 78, 127, 160, 169
AspS9I GGNCC 1 cut(s) 127
AsuHPI GGTGA 2 cut(s) 176, 280
AsuII TTCGAA 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 173
BfaI CTAG 2 cut(s) 111, 210
BglI GCCNNNNNGGC 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 173
BmgT120I GGNCC 1 cut(s) 127
BmiI GGNNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 173
Bpu14I TTCGAA 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 249
BseBI CCWGG 1 cut(s) 173
BseLI CCNNNNNNNGG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 180
BseYI CCCAGC 1 cut(s) 205
BshFI GGCC 4 cut(s) 80, 129, 162, 171
BslI CCNNNNNNNGG 1 cut(s) 249
BsnI GGCC 4 cut(s) 80, 129, 162, 171
Bsp119I TTCGAA 1 cut(s) 60
Bsp143I GATC 2 cut(s) 38, 246
BspANI GGCC 4 cut(s) 80, 129, 162, 171
BspCNI CTCAG 1 cut(s) 179
BspLI GGNNCC 1 cut(s) 128
BspPI GGATC 1 cut(s) 46
BspT104I TTCGAA 1 cut(s) 60
BssMI GATC 2 cut(s) 38, 246
Bst2UI CCWGG 1 cut(s) 173
Bst4CI ACNGT 2 cut(s) 67, 97
Bst6I CTCTTC 1 cut(s) 116
BstBI TTCGAA 1 cut(s) 60
BstDEI CTNAG 2 cut(s) 15, 166
BstKTI GATC 2 cut(s) 41, 249
BstMBI GATC 2 cut(s) 38, 246
BstMWI GCNNNNNNNGC 4 cut(s) 168, 206, 215, 224
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
BsuRI GGCC 4 cut(s) 80, 129, 162, 171
BtsIMutI CAGTG 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 127
CviJI RGCY 7 cut(s) 80, 129, 137, 162, 171, 200, 209
CviKI_1 RGCY 7 cut(s) 80, 129, 137, 162, 171, 200, 209
DdeI CTNAG 2 cut(s) 15, 166
DpnI GATC 2 cut(s) 40, 248
DpnII GATC 2 cut(s) 38, 246
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
EcoO109I RGGNCCY 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 171
FaiI YATR 1 cut(s) 24
FspBI CTAG 2 cut(s) 111, 210
GsaI CCCAGC 1 cut(s) 209
HaeIII GGCC 4 cut(s) 80, 129, 162, 171
HincII GTYRAC 1 cut(s) 105
HindII GTYRAC 1 cut(s) 105
HinfI GANTC 5 cut(s) 8, 51, 57, 90, 155
HpaI GTTAAC 1 cut(s) 105
HphI GGTGA 2 cut(s) 176, 280
Hpy166II GTNNAC 2 cut(s) 105, 271
Hpy188I TCNGA 1 cut(s) 56
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 2 cut(s) 105, 271
HpyCH4III ACNGT 2 cut(s) 67, 97
HpyCH4V TGCA 2 cut(s) 26, 278
HpyF10VI GCNNNNNNNGC 4 cut(s) 168, 206, 215, 224
HpyF3I CTNAG 2 cut(s) 15, 166
KspAI GTTAAC 1 cut(s) 105
Kzo9I GATC 2 cut(s) 38, 246
LpnPI CCDG 9 cut(s) 21, 144, 153, 158, 185, 209, 219, 257, 264
MaeI CTAG 2 cut(s) 111, 210
MaeIII GTNAC 1 cut(s) 31
MalI GATC 2 cut(s) 40, 248
MboI GATC 2 cut(s) 38, 246
MboII GAAGA 1 cut(s) 133
MluCI AATT 2 cut(s) 230, 282
MlyI GAGTC 1 cut(s) 164
MnlI CCTC 4 cut(s) 12, 91, 117, 173
MseI TTAA 1 cut(s) 104
MslI CAYNNNNRTG 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
MwoI GCNNNNNNNGC 4 cut(s) 168, 206, 215, 224
NdeII GATC 2 cut(s) 38, 246
NlaIV GGNNCC 1 cut(s) 128
NmuCI GTSAC 1 cut(s) 31
NspV TTCGAA 1 cut(s) 60
OliI CACNNNNGTG 1 cut(s) 98
PcsI WCGNNNNNNNCGW 1 cut(s) 255
PfeI GAWTC 4 cut(s) 8, 51, 57, 90
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 171
PspFI CCCAGC 1 cut(s) 205
PspGI CCWGG 1 cut(s) 171
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 98
SaqAI TTAA 1 cut(s) 104
Sau3AI GATC 2 cut(s) 38, 246
Sau96I GGNCC 1 cut(s) 127
SchI GAGTC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 173
SetI ASST 4 cut(s) 23, 139, 177, 211
SfiI GGCCNNNNNGGCC 1 cut(s) 168
SfuI TTCGAA 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 98
Sse9I AATT 2 cut(s) 230, 282
SspMI CTAG 2 cut(s) 111, 210
StyD4I CCNGG 1 cut(s) 171
TaaI ACNGT 2 cut(s) 67, 97
TaqI TCGA 2 cut(s) 60, 258
TasI AATT 2 cut(s) 230, 282
TfiI GAWTC 4 cut(s) 8, 51, 57, 90
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TscAI CASTG 1 cut(s) 102
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 223
TspRI CASTG 1 cut(s) 102
XspI CTAG 2 cut(s) 111, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.