RchiOBHm_Chr6g0298071

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
59600411 .. 59600879
469 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26755

Sequence Viewer

Length: 150 bp
ATGATGACAATACCTGATTTAGAAAAAGACCTTCGTTGGAGAGCAATTGAAGTATTTGCTAACAAGGCGACAAAGTTTCAAATATTAAAGAAAATTTCACTTGAGAAGAAAAGTGAATTTGTTTTGAAGTCAATGCCACGAGATTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.87

Weight (kDa)

9.77

Isoelectric Point (pI)

44.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000244)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02550 AT4G02550 AT4G02550 AT4G02550 AT4G02550
fragaria_vesca FvH4_1g20120 FvH4_2g13781 FvH4_4g15662 FvH4_6g32032
malus_domestica MD02G1272200.v1.1 MD04G1174600.v1.1 MD07G1041200.v1.1 MD07G1064000.v1.1
prunus_persica Prupe.1G245200_v2.0.a1 Prupe.1G287900_v2.0.a1 Prupe.2G077600_v2.0.a1 Prupe.2G078000_v2.0.a1 Prupe.3G281200_v2.0.a1 Prupe.4G256700_v2.0.a1 Prupe.5G014200_v2.0.a1 Prupe.5G014400_v2.0.a1 Prupe.5G049300_v2.0.a1 Prupe.5G049400_v2.0.a1 Prupe.6G167700_v2.0.a1 Prupe.7G027800_v2.0.a1
pyrus_communis pycom02g23280 pycom07g02860 pycom07g04940 pycom07g04960 pycom07g04980
rosa_chinensis RchiOBHm_Chr1g0330381 RchiOBHm_Chr2g0139691 RchiOBHm_Chr2g0145201 RchiOBHm_Chr3g0485151 RchiOBHm_Chr4g0405761 RchiOBHm_Chr4g0417571 RchiOBHm_Chr5g0022261 RchiOBHm_Chr5g0053961 RchiOBHm_Chr6g0298071 RchiOBHm_Chr7g0231381
rosa_laevigata RLG00000002919 RLG00000009166 RLG00000013803 RLG00000013816 RLG00000015126 RLG00000017423 RLG00000019811 RLG00000019826 RLG00000028831 RLG00000029802 RLG00000029840 RLG00000029955 RLG00000029956 RLG00000034858
rosa_multiflora Rmu_co8446275.1_g000001 Rmu_sc0000212.1_g000021 Rmu_sc0000945.1_g000025 Rmu_sc0001512.1_g000009 Rmu_sc0003482.1_g000004 Rmu_sc0004039.1_g000001 Rmu_sc0004390.1_g000008 Rmu_sc0004711.1_g000022 Rmu_sc0005887.1_g000001 Rmu_sc0007795.1_g000002 Rmu_sc0008148.1_g000034 Rmu_sc0008927.1_g000001 Rmu_sc0009714.1_g000007 Rmu_sc0009806.1_g000002 Rmu_sc0012995.1_g000005 Rmu_sc0014278.1_g000005 Rmu_sc0023501.1_g000002
rosa_roxburghii Rroxscaffold_2G00105280 Rroxscaffold_2G00111200 Rroxscaffold_2G00117910 Rroxscaffold_3G00235020 Rroxscaffold_5G00350240 Rroxscaffold_5G00381630 Rroxscaffold_6G00403970 Rroxscaffold_7G00158580
rosa_rugosa Rorug01G0012500 Rorug02G0357800 Rorug02G0359000 Rorug02G0359100 Rorug02G0359200 Rorug04G0061200 Rorug04G0162600 Rorug05G0271800 Rorug06G0213500 Rorug06G0213600 Rorug06G0332900 Rorug07G0148200
rosa_samantha Rh1AG259900 Rh1AG410300 Rh2AG397400 Rh2AG397500 Rh2AG409000 Rh2BG187200 Rh2BG417700 Rh2BG419500 Rh2BG460700 Rh2CG384200 Rh2CG384300 Rh2CG395100 Rh2DG065900 Rh2DG428800 Rh3CG301800 Rh3DG242800 Rh4BG141800 Rh4CG022100 Rh5BG548900 Rh5CG571800 Rh6AG328800 Rh6CG021500 Rh6CG066400 Rh6CG237200 Rh6DG021700 Rh6DG063300 Rh7AG131700 Rh7BG051800 Rh7CG385100 Rh7DG025500 Rh7DG025600
rosa_wichuraiana Rw0G007310 Rw0G016860 Rw2G029630 Rw2G033470 Rw2G034500 Rw3G014930 Rw3G019520 Rw4G010080 Rw4G016450 Rw5G023350 Rw5G041160 Rw5G048810 Rw6G006750 Rw6G017100 Rw7G031010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 93, 116
AgsI TTSAA 3 cut(s) 50, 80, 127
ApoI RAATTY 2 cut(s) 93, 116
BauI CACGAG 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 122
BssSI CACGAG 1 cut(s) 138
Bst2BI CACGAG 1 cut(s) 138
BstMWI GCNNNNNNNGC 1 cut(s) 65
FspEI CC 4 cut(s) 22, 27, 44, 50
HpyAV CCTTC 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
LpnPI CCDG 1 cut(s) 27
MboII GAAGA 1 cut(s) 118
MfeI CAATTG 1 cut(s) 45
MluCI AATT 3 cut(s) 45, 93, 116
MmeI TCCRAC 1 cut(s) 17
MseI TTAA 1 cut(s) 86
MunI CAATTG 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 86
SetI ASST 2 cut(s) 16, 33
SgeI CNNG 3 cut(s) 26, 76, 113
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 3 cut(s) 45, 93, 116
SspI AATATT 1 cut(s) 84
TasI AATT 3 cut(s) 45, 93, 116
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XapI RAATTY 2 cut(s) 93, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.