Rmu_sc0012995.1_g000005
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012995.1
Physical Location & Seq
Forward (+)
15880 .. 16615
736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012995.1_g000005.1.cds

Sequence Viewer

Length: 648 bp
atgagtagacttggaggaaatgaggttaaaaatcgaaaatcaaatggaaacaatgaaggaaaggctgaaggcaagaactatttgcagtggaatttagatatggagcgtgctttggctgatatacttcgtgaggaacgaggtctgggccataaaggagataatggttggaaagctgtagcttataatacagctgttgatattttatctgcacagtttgatattcaaatatctgctgacaatataaaaaaccgtgtgaaatcatggaaaaagttctatggaattgttagtgatatcttgagccaaagtggatttagctgggattcctcaacacaaatgataagcattgatgaaaacagtgtatgggaagaatatgtgaagtctcatgatgaagctataagctttcggtttaaaagaatcctaaattgggatgatatagttgatttgtgtggcaaagatagagccattggagagggtgctaaaacaggtttcgaagccactgaggttatgactcctcctgctaatgaagataatcatgtcgatttggaaggtgataaccaagcatcagaagatattcacatcattgagaacatttcaccgaaccaagcaagttctcagaaaaagagaaatgaagcaatttttttttcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

215

Amino Acids

24.2

Weight (kDa)

4.95

Isoelectric Point (pI)

39.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000244)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02550 AT4G02550 AT4G02550 AT4G02550 AT4G02550
fragaria_vesca FvH4_1g20120 FvH4_2g13781 FvH4_4g15662 FvH4_6g32032
malus_domestica MD02G1272200.v1.1 MD04G1174600.v1.1 MD07G1041200.v1.1 MD07G1064000.v1.1
prunus_persica Prupe.1G245200_v2.0.a1 Prupe.1G287900_v2.0.a1 Prupe.2G077600_v2.0.a1 Prupe.2G078000_v2.0.a1 Prupe.3G281200_v2.0.a1 Prupe.4G256700_v2.0.a1 Prupe.5G014200_v2.0.a1 Prupe.5G014400_v2.0.a1 Prupe.5G049300_v2.0.a1 Prupe.5G049400_v2.0.a1 Prupe.6G167700_v2.0.a1 Prupe.7G027800_v2.0.a1
pyrus_communis pycom02g23280 pycom07g02860 pycom07g04940 pycom07g04960 pycom07g04980
rosa_chinensis RchiOBHm_Chr1g0330381 RchiOBHm_Chr2g0139691 RchiOBHm_Chr2g0145201 RchiOBHm_Chr3g0485151 RchiOBHm_Chr4g0405761 RchiOBHm_Chr4g0417571 RchiOBHm_Chr5g0022261 RchiOBHm_Chr5g0053961 RchiOBHm_Chr6g0298071 RchiOBHm_Chr7g0231381
rosa_laevigata RLG00000002919 RLG00000009166 RLG00000013803 RLG00000013816 RLG00000015126 RLG00000017423 RLG00000019811 RLG00000019826 RLG00000028831 RLG00000029802 RLG00000029840 RLG00000029955 RLG00000029956 RLG00000034858
rosa_multiflora Rmu_co8446275.1_g000001 Rmu_sc0000212.1_g000021 Rmu_sc0000945.1_g000025 Rmu_sc0001512.1_g000009 Rmu_sc0003482.1_g000004 Rmu_sc0004039.1_g000001 Rmu_sc0004390.1_g000008 Rmu_sc0004711.1_g000022 Rmu_sc0005887.1_g000001 Rmu_sc0007795.1_g000002 Rmu_sc0008148.1_g000034 Rmu_sc0008927.1_g000001 Rmu_sc0009714.1_g000007 Rmu_sc0009806.1_g000002 Rmu_sc0012995.1_g000005 Rmu_sc0014278.1_g000005 Rmu_sc0023501.1_g000002
rosa_roxburghii Rroxscaffold_2G00105280 Rroxscaffold_2G00111200 Rroxscaffold_2G00117910 Rroxscaffold_3G00235020 Rroxscaffold_5G00350240 Rroxscaffold_5G00381630 Rroxscaffold_6G00403970 Rroxscaffold_7G00158580
rosa_rugosa Rorug01G0012500 Rorug02G0357800 Rorug02G0359000 Rorug02G0359100 Rorug02G0359200 Rorug04G0061200 Rorug04G0162600 Rorug05G0271800 Rorug06G0213500 Rorug06G0213600 Rorug06G0332900 Rorug07G0148200
rosa_samantha Rh1AG259900 Rh1AG410300 Rh2AG397400 Rh2AG397500 Rh2AG409000 Rh2BG187200 Rh2BG417700 Rh2BG419500 Rh2BG460700 Rh2CG384200 Rh2CG384300 Rh2CG395100 Rh2DG065900 Rh2DG428800 Rh3CG301800 Rh3DG242800 Rh4BG141800 Rh4CG022100 Rh5BG548900 Rh5CG571800 Rh6AG328800 Rh6CG021500 Rh6CG066400 Rh6CG237200 Rh6DG021700 Rh6DG063300 Rh7AG131700 Rh7BG051800 Rh7CG385100 Rh7DG025500 Rh7DG025600
rosa_wichuraiana Rw0G007310 Rw0G016860 Rw2G029630 Rw2G033470 Rw2G034500 Rw3G014930 Rw3G019520 Rw4G010080 Rw4G016450 Rw5G023350 Rw5G041160 Rw5G048810 Rw6G006750 Rw6G017100 Rw7G031010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 183
AccI GTMKAC 1 cut(s) 7
AcsI RAATTY 1 cut(s) 91
AcuI CTGAAG 1 cut(s) 87
AfiI CCNNNNNNNGG 1 cut(s) 424
AgsI TTSAA 1 cut(s) 224
AjuI GAANNNNNNNTTGG 2 cut(s) 406, 438
AluBI AGCT 6 cut(s) 173, 179, 191, 315, 392, 399
AluI AGCT 6 cut(s) 173, 179, 191, 315, 392, 399
Alw26I GTCTC 1 cut(s) 384
AoxI GGCC 1 cut(s) 145
ApoI RAATTY 1 cut(s) 91
Asp700I GAANNNNTTC 2 cut(s) 269, 570
AspS9I GGNCC 1 cut(s) 145
AsuHPI GGTGA 2 cut(s) 560, 585
AsuII TTCGAA 1 cut(s) 489
BcoDI GTCTC 1 cut(s) 384
BfmI CTRYAG 1 cut(s) 174
BmgT120I GGNCC 1 cut(s) 145
BmsI GCATC 1 cut(s) 569
Bpu14I TTCGAA 1 cut(s) 489
BpuEI CTTGAG 1 cut(s) 316
Bsc4I CCNNNNNNNGG 1 cut(s) 424
BseGI GGATG 1 cut(s) 433
BseLI CCNNNNNNNGG 1 cut(s) 424
BseMII CTCAG 2 cut(s) 489, 626
BseRI GAGGAG 1 cut(s) 501
BseYI CCCAGC 1 cut(s) 315
BsgI GTGCAG 1 cut(s) 192
BshFI GGCC 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 424
BsmAI GTCTC 1 cut(s) 384
BsnI GGCC 1 cut(s) 147
Bsp119I TTCGAA 1 cut(s) 489
BspANI GGCC 1 cut(s) 147
BspCNI CTCAG 2 cut(s) 490, 625
BspHI TCATGA 1 cut(s) 382
BspT104I TTCGAA 1 cut(s) 489
Bst4CI ACNGT 3 cut(s) 213, 251, 356
BstBI TTCGAA 1 cut(s) 489
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 2 cut(s) 498, 612
BstF5I GGATG 1 cut(s) 433
BstMAI GTCTC 1 cut(s) 384
BstSFI CTRYAG 1 cut(s) 174
BsuRI GGCC 1 cut(s) 147
BtsCI GGATG 1 cut(s) 433
BtsI GCAGTG 1 cut(s) 92
BtsIMutI CAGTG 3 cut(s) 92, 361, 495
Cac8I GCNNGC 1 cut(s) 108
CciI TCATGA 1 cut(s) 382
Cfr13I GGNCC 1 cut(s) 145
CviAII CATG 3 cut(s) 261, 383, 533
DdeI CTNAG 2 cut(s) 498, 612
DraI TTTAAA 1 cut(s) 409
Eco32I GATATC 1 cut(s) 292
Eco57I CTGAAG 1 cut(s) 87
EcoRV GATATC 1 cut(s) 292
FaeI CATG 3 cut(s) 264, 386, 536
FatI CATG 3 cut(s) 260, 382, 532
FblI GTMKAC 1 cut(s) 7
FokI GGATG 1 cut(s) 440
GsaI CCCAGC 1 cut(s) 319
HaeIII GGCC 1 cut(s) 147
Hin1II CATG 3 cut(s) 264, 386, 536
HindIII AAGCTT 1 cut(s) 397
HinfI GANTC 3 cut(s) 320, 414, 508
HphI GGTGA 2 cut(s) 560, 585
Hpy166II GTNNAC 1 cut(s) 8
Hpy188I TCNGA 2 cut(s) 565, 615
Hpy188III TCNNGA 3 cut(s) 128, 295, 383
Hpy8I GTNNAC 1 cut(s) 8
HpyAV CCTTC 3 cut(s) 50, 62, 539
HpyCH4III ACNGT 3 cut(s) 213, 251, 356
HpyCH4V TGCA 2 cut(s) 85, 209
HpyF3I CTNAG 2 cut(s) 498, 612
Hsp92II CATG 3 cut(s) 264, 386, 536
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 4 cut(s) 128, 301, 468, 528
LweI GCATC 1 cut(s) 569
MboII GAAGA 3 cut(s) 377, 536, 578
MluCI AATT 4 cut(s) 91, 279, 421, 633
MlyI GAGTC 1 cut(s) 502
MmeI TCCRAC 1 cut(s) 146
MnlI CCTC 8 cut(s) 8, 16, 124, 131, 334, 463, 493, 522
MroXI GAANNNNTTC 2 cut(s) 269, 570
MseI TTAA 2 cut(s) 27, 408
MspA1I CMGCKG 1 cut(s) 191
NlaIII CATG 3 cut(s) 264, 386, 536
NspV TTCGAA 1 cut(s) 489
PagI TCATGA 1 cut(s) 382
PcsI WCGNNNNNNNCGW 1 cut(s) 133
PdmI GAANNNNTTC 2 cut(s) 269, 570
PfeI GAWTC 2 cut(s) 320, 414
PleI GAGTC 1 cut(s) 502
PpsI GAGTC 1 cut(s) 502
PsiI TTATAA 1 cut(s) 183
PspFI CCCAGC 1 cut(s) 315
PspPI GGNCC 1 cut(s) 145
PvuII CAGCTG 1 cut(s) 191
SaqAI TTAA 2 cut(s) 27, 408
Sau96I GGNCC 1 cut(s) 145
SchI GAGTC 1 cut(s) 502
SfaNI GCATC 1 cut(s) 569
SfcI CTRYAG 1 cut(s) 174
SfuI TTCGAA 1 cut(s) 489
SmlI CTYRAG 1 cut(s) 295
SmoI CTYRAG 1 cut(s) 295
Sse9I AATT 4 cut(s) 91, 279, 421, 633
TaaI ACNGT 3 cut(s) 213, 251, 356
TaqI TCGA 3 cut(s) 34, 489, 537
TasI AATT 4 cut(s) 91, 279, 421, 633
TfiI GAWTC 2 cut(s) 320, 414
Tru1I TTAA 2 cut(s) 27, 408
Tru9I TTAA 2 cut(s) 27, 408
TscAI CASTG 3 cut(s) 92, 361, 502
TspDTI ATGAA 6 cut(s) 69, 363, 402, 537, 633, 642
TspRI CASTG 3 cut(s) 92, 361, 502
XapI RAATTY 1 cut(s) 91
XmiI GTMKAC 1 cut(s) 7
XmnI GAANNNNTTC 2 cut(s) 269, 570
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.