Rmu_co8446275.1_g000001
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8446275.1
OG0000244
Physical Location & Seq
Forward (+)
1244 .. 1639
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8446275.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
atgagcagacttggagaaaatgaggtcaaaaaccgaaaaacaaatggaaagagcaaaggaaagactgaaggcaagaattatttgcagtggaatttagatatggggcgtgctttggctgacatacttggtgaggaaagaggcttaggccataaaggagataatggttggaaagctgtaacttataatacagctgctgatattttatctgcacaatttgatattcaaataattgctgacaatataaaaaatcgtgtgaagtcatggaaaaagctttatggaattgtaagtgatatcttgagccaaagtggatttagttgggattcctcaacacaaatgataattgtcgatgaaaacaacgtatgggaagaatatgtgaaggtatgtaactttcattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

131

Amino Acids

14.84

Weight (kDa)

7.81

Isoelectric Point (pI)

23.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000244)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02550 AT4G02550 AT4G02550 AT4G02550 AT4G02550
fragaria_vesca FvH4_1g20120 FvH4_2g13781 FvH4_4g15662 FvH4_6g32032
malus_domestica MD02G1272200.v1.1 MD04G1174600.v1.1 MD07G1041200.v1.1 MD07G1064000.v1.1
prunus_persica Prupe.1G245200_v2.0.a1 Prupe.1G287900_v2.0.a1 Prupe.2G077600_v2.0.a1 Prupe.2G078000_v2.0.a1 Prupe.3G281200_v2.0.a1 Prupe.4G256700_v2.0.a1 Prupe.5G014200_v2.0.a1 Prupe.5G014400_v2.0.a1 Prupe.5G049300_v2.0.a1 Prupe.5G049400_v2.0.a1 Prupe.6G167700_v2.0.a1 Prupe.7G027800_v2.0.a1
pyrus_communis pycom02g23280 pycom07g02860 pycom07g04940 pycom07g04960 pycom07g04980
rosa_chinensis RchiOBHm_Chr1g0330381 RchiOBHm_Chr2g0139691 RchiOBHm_Chr2g0145201 RchiOBHm_Chr3g0485151 RchiOBHm_Chr4g0405761 RchiOBHm_Chr4g0417571 RchiOBHm_Chr5g0022261 RchiOBHm_Chr5g0053961 RchiOBHm_Chr6g0298071 RchiOBHm_Chr7g0231381
rosa_laevigata RLG00000002919 RLG00000009166 RLG00000013803 RLG00000013816 RLG00000015126 RLG00000017423 RLG00000019811 RLG00000019826 RLG00000028831 RLG00000029802 RLG00000029840 RLG00000029955 RLG00000029956 RLG00000034858
rosa_multiflora Rmu_co8446275.1_g000001 Rmu_sc0000212.1_g000021 Rmu_sc0000945.1_g000025 Rmu_sc0001512.1_g000009 Rmu_sc0003482.1_g000004 Rmu_sc0004039.1_g000001 Rmu_sc0004390.1_g000008 Rmu_sc0004711.1_g000022 Rmu_sc0005887.1_g000001 Rmu_sc0007795.1_g000002 Rmu_sc0008148.1_g000034 Rmu_sc0008927.1_g000001 Rmu_sc0009714.1_g000007 Rmu_sc0009806.1_g000002 Rmu_sc0012995.1_g000005 Rmu_sc0014278.1_g000005 Rmu_sc0023501.1_g000002
rosa_roxburghii Rroxscaffold_2G00105280 Rroxscaffold_2G00111200 Rroxscaffold_2G00117910 Rroxscaffold_3G00235020 Rroxscaffold_5G00350240 Rroxscaffold_5G00381630 Rroxscaffold_6G00403970 Rroxscaffold_7G00158580
rosa_rugosa Rorug01G0012500 Rorug02G0357800 Rorug02G0359000 Rorug02G0359100 Rorug02G0359200 Rorug04G0061200 Rorug04G0162600 Rorug05G0271800 Rorug06G0213500 Rorug06G0213600 Rorug06G0332900 Rorug07G0148200
rosa_samantha Rh1AG259900 Rh1AG410300 Rh2AG397400 Rh2AG397500 Rh2AG409000 Rh2BG187200 Rh2BG417700 Rh2BG419500 Rh2BG460700 Rh2CG384200 Rh2CG384300 Rh2CG395100 Rh2DG065900 Rh2DG428800 Rh3CG301800 Rh3DG242800 Rh4BG141800 Rh4CG022100 Rh5BG548900 Rh5CG571800 Rh6AG328800 Rh6CG021500 Rh6CG066400 Rh6CG237200 Rh6DG021700 Rh6DG063300 Rh7AG131700 Rh7BG051800 Rh7CG385100 Rh7DG025500 Rh7DG025600
rosa_wichuraiana Rw0G007310 Rw0G016860 Rw2G029630 Rw2G033470 Rw2G034500 Rw3G014930 Rw3G019520 Rw4G010080 Rw4G016450 Rw5G023350 Rw5G041160 Rw5G048810 Rw6G006750 Rw6G017100 Rw7G031010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 183
AcsI RAATTY 1 cut(s) 91
AcuI CTGAAG 1 cut(s) 87
AgsI TTSAA 1 cut(s) 224
AluBI AGCT 3 cut(s) 173, 191, 271
AluI AGCT 3 cut(s) 173, 191, 271
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 1 cut(s) 145
ApeKI GCWGC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 140
BbvI GCAGC 1 cut(s) 178
BisI GCNGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 193
Bpu10I CCTNAGC 1 cut(s) 142
BpuEI CTTGAG 1 cut(s) 316
BseXI GCAGC 1 cut(s) 178
BsgI GTGCAG 1 cut(s) 192
BshFI GGCC 1 cut(s) 147
BsnI GGCC 1 cut(s) 147
BspANI GGCC 1 cut(s) 147
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 142
BstV1I GCAGC 1 cut(s) 178
BsuRI GGCC 1 cut(s) 147
BtsI GCAGTG 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 92
Cac8I GCNNGC 1 cut(s) 108
CaiI CAGNNNCTG 1 cut(s) 194
CviAII CATG 1 cut(s) 261
CviJI RGCY 7 cut(s) 116, 141, 147, 173, 191, 271, 300
CviKI_1 RGCY 7 cut(s) 116, 141, 147, 173, 191, 271, 300
DdeI CTNAG 1 cut(s) 142
Eco32I GATATC 1 cut(s) 292
Eco57I CTGAAG 1 cut(s) 87
EcoRV GATATC 1 cut(s) 292
FaeI CATG 1 cut(s) 264
FatI CATG 1 cut(s) 260
Fnu4HI GCNGC 1 cut(s) 192
Fsp4HI GCNGC 1 cut(s) 192
GluI GCNGC 1 cut(s) 192
HaeIII GGCC 1 cut(s) 147
Hin1II CATG 1 cut(s) 264
HindIII AAGCTT 1 cut(s) 269
HinfI GANTC 1 cut(s) 320
HphI GGTGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 295
HpyAV CCTTC 2 cut(s) 62, 370
HpyCH4IV ACGT 1 cut(s) 357
HpyCH4V TGCA 2 cut(s) 85, 209
HpyF3I CTNAG 1 cut(s) 142
HpySE526I ACGT 1 cut(s) 357
Hsp92II CATG 1 cut(s) 264
Lsp1109I GCAGC 1 cut(s) 178
MaeII ACGT 1 cut(s) 357
MaeIII GTNAC 2 cut(s) 175, 383
MboII GAAGA 1 cut(s) 377
MluCI AATT 6 cut(s) 76, 91, 212, 228, 279, 339
MmeI TCCRAC 1 cut(s) 146
MnlI CCTC 4 cut(s) 16, 124, 131, 334
MseI TTAA 1 cut(s) 394
MspA1I CMGCKG 1 cut(s) 191
NlaIII CATG 1 cut(s) 264
PfeI GAWTC 1 cut(s) 320
PkrI GCNGC 1 cut(s) 193
PsiI TTATAA 1 cut(s) 183
PstNI CAGNNNCTG 1 cut(s) 194
PvuII CAGCTG 1 cut(s) 191
SaqAI TTAA 1 cut(s) 394
SatI GCNGC 1 cut(s) 192
SetI ASST 6 cut(s) 27, 175, 193, 273, 360, 381
SgeI CNNG 7 cut(s) 23, 85, 119, 137, 263, 273, 307
SmlI CTYRAG 1 cut(s) 295
SmoI CTYRAG 1 cut(s) 295
Sse9I AATT 6 cut(s) 76, 91, 212, 228, 279, 339
TaiI ACGT 1 cut(s) 360
TaqI TCGA 1 cut(s) 345
TasI AATT 6 cut(s) 76, 91, 212, 228, 279, 339
TfiI GAWTC 1 cut(s) 320
Tru1I TTAA 1 cut(s) 394
Tru9I TTAA 1 cut(s) 394
TscAI CASTG 1 cut(s) 92
TseI GCWGC 1 cut(s) 191
TspDTI ATGAA 2 cut(s) 363, 380
TspRI CASTG 1 cut(s) 92
XapI RAATTY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.