Rmu_sc0005887.1_g000001
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005887.1
OG0000244
Physical Location & Seq
Forward (+)
974 .. 1381
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005887.1_g000001.1.cds

Sequence Viewer

Length: 408 bp
atgagtagacttggaggaaatgagatcaaaaaccaaaaaccaaatgtaaagaatgaaggaaagagcaaaggaaaggccgaaggcaagaactatttgcagtggaatttaaatatcgagcatgctttggctgatatacttcgtgaggaacgaggtctgggccataaaggagataatggttggaaagctgtagcttataatacagctgctgatattttatctgcacagtttgatattcaaataagtgctgacaatataaaaaacagtgtgaaatcagggaaaaagttctatggaattgttagtgatatcttgagccaaagtggatttagctgggtatcctcaacacaaatgataagctttgatgaaaacagtgtatgggaagaatatgtgaaggtatgtaaattttattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

135

Amino Acids

15.12

Weight (kDa)

8.59

Isoelectric Point (pI)

39.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000244)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02550 AT4G02550 AT4G02550 AT4G02550 AT4G02550
fragaria_vesca FvH4_1g20120 FvH4_2g13781 FvH4_4g15662 FvH4_6g32032
malus_domestica MD02G1272200.v1.1 MD04G1174600.v1.1 MD07G1041200.v1.1 MD07G1064000.v1.1
prunus_persica Prupe.1G245200_v2.0.a1 Prupe.1G287900_v2.0.a1 Prupe.2G077600_v2.0.a1 Prupe.2G078000_v2.0.a1 Prupe.3G281200_v2.0.a1 Prupe.4G256700_v2.0.a1 Prupe.5G014200_v2.0.a1 Prupe.5G014400_v2.0.a1 Prupe.5G049300_v2.0.a1 Prupe.5G049400_v2.0.a1 Prupe.6G167700_v2.0.a1 Prupe.7G027800_v2.0.a1
pyrus_communis pycom02g23280 pycom07g02860 pycom07g04940 pycom07g04960 pycom07g04980
rosa_chinensis RchiOBHm_Chr1g0330381 RchiOBHm_Chr2g0139691 RchiOBHm_Chr2g0145201 RchiOBHm_Chr3g0485151 RchiOBHm_Chr4g0405761 RchiOBHm_Chr4g0417571 RchiOBHm_Chr5g0022261 RchiOBHm_Chr5g0053961 RchiOBHm_Chr6g0298071 RchiOBHm_Chr7g0231381
rosa_laevigata RLG00000002919 RLG00000009166 RLG00000013803 RLG00000013816 RLG00000015126 RLG00000017423 RLG00000019811 RLG00000019826 RLG00000028831 RLG00000029802 RLG00000029840 RLG00000029955 RLG00000029956 RLG00000034858
rosa_multiflora Rmu_co8446275.1_g000001 Rmu_sc0000212.1_g000021 Rmu_sc0000945.1_g000025 Rmu_sc0001512.1_g000009 Rmu_sc0003482.1_g000004 Rmu_sc0004039.1_g000001 Rmu_sc0004390.1_g000008 Rmu_sc0004711.1_g000022 Rmu_sc0005887.1_g000001 Rmu_sc0007795.1_g000002 Rmu_sc0008148.1_g000034 Rmu_sc0008927.1_g000001 Rmu_sc0009714.1_g000007 Rmu_sc0009806.1_g000002 Rmu_sc0012995.1_g000005 Rmu_sc0014278.1_g000005 Rmu_sc0023501.1_g000002
rosa_roxburghii Rroxscaffold_2G00105280 Rroxscaffold_2G00111200 Rroxscaffold_2G00117910 Rroxscaffold_3G00235020 Rroxscaffold_5G00350240 Rroxscaffold_5G00381630 Rroxscaffold_6G00403970 Rroxscaffold_7G00158580
rosa_rugosa Rorug01G0012500 Rorug02G0357800 Rorug02G0359000 Rorug02G0359100 Rorug02G0359200 Rorug04G0061200 Rorug04G0162600 Rorug05G0271800 Rorug06G0213500 Rorug06G0213600 Rorug06G0332900 Rorug07G0148200
rosa_samantha Rh1AG259900 Rh1AG410300 Rh2AG397400 Rh2AG397500 Rh2AG409000 Rh2BG187200 Rh2BG417700 Rh2BG419500 Rh2BG460700 Rh2CG384200 Rh2CG384300 Rh2CG395100 Rh2DG065900 Rh2DG428800 Rh3CG301800 Rh3DG242800 Rh4BG141800 Rh4CG022100 Rh5BG548900 Rh5CG571800 Rh6AG328800 Rh6CG021500 Rh6CG066400 Rh6CG237200 Rh6DG021700 Rh6DG063300 Rh7AG131700 Rh7BG051800 Rh7CG385100 Rh7DG025500 Rh7DG025600
rosa_wichuraiana Rw0G007310 Rw0G016860 Rw2G029630 Rw2G033470 Rw2G034500 Rw3G014930 Rw3G019520 Rw4G010080 Rw4G016450 Rw5G023350 Rw5G041160 Rw5G048810 Rw6G006750 Rw6G017100 Rw7G031010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 195
AccI GTMKAC 1 cut(s) 7
AcsI RAATTY 2 cut(s) 103, 398
AgsI TTSAA 1 cut(s) 236
AluBI AGCT 5 cut(s) 185, 191, 203, 327, 354
AluI AGCT 5 cut(s) 185, 191, 203, 327, 354
AlwNI CAGNNNCTG 1 cut(s) 206
AoxI GGCC 2 cut(s) 75, 157
ApeKI GCWGC 1 cut(s) 203
ApoI RAATTY 2 cut(s) 103, 398
Asp700I GAANNNNTTC 1 cut(s) 281
AspS9I GGNCC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 190
BciVI GTATCC 1 cut(s) 343
BfmI CTRYAG 1 cut(s) 186
BfuI GTATCC 1 cut(s) 343
BisI GCNGC 1 cut(s) 204
BlsI GCNGC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 328
BseXI GCAGC 1 cut(s) 190
BseYI CCCAGC 1 cut(s) 327
BsgI GTGCAG 1 cut(s) 204
BshFI GGCC 2 cut(s) 77, 159
BsnI GGCC 2 cut(s) 77, 159
Bsp143I GATC 1 cut(s) 24
BspANI GGCC 2 cut(s) 77, 159
BssMI GATC 1 cut(s) 24
Bst4CI ACNGT 3 cut(s) 225, 263, 368
BstC8I GCNNGC 1 cut(s) 120
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BstNSI RCATGY 1 cut(s) 122
BstSFI CTRYAG 1 cut(s) 186
BstV1I GCAGC 1 cut(s) 190
BsuI GTATCC 1 cut(s) 343
BsuRI GGCC 2 cut(s) 77, 159
BtsI GCAGTG 1 cut(s) 104
BtsIMutI CAGTG 3 cut(s) 104, 268, 373
Cac8I GCNNGC 1 cut(s) 120
CaiI CAGNNNCTG 1 cut(s) 206
Cfr13I GGNCC 1 cut(s) 157
CviAII CATG 1 cut(s) 119
CviJI RGCY 9 cut(s) 77, 128, 159, 185, 191, 203, 312, 327, 354
CviKI_1 RGCY 9 cut(s) 77, 128, 159, 185, 191, 203, 312, 327, 354
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
DraI TTTAAA 1 cut(s) 108
Eco32I GATATC 1 cut(s) 304
EcoRV GATATC 1 cut(s) 304
FaeI CATG 1 cut(s) 122
FaiI YATR 9 cut(s) 120, 134, 162, 195, 254, 288, 373, 384, 394
FatI CATG 1 cut(s) 118
FblI GTMKAC 1 cut(s) 7
Fnu4HI GCNGC 1 cut(s) 204
Fsp4HI GCNGC 1 cut(s) 204
GluI GCNGC 1 cut(s) 204
GsaI CCCAGC 1 cut(s) 331
HaeIII GGCC 2 cut(s) 77, 159
Hin1II CATG 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 352
Hpy166II GTNNAC 1 cut(s) 8
Hpy188III TCNNGA 2 cut(s) 140, 307
Hpy8I GTNNAC 1 cut(s) 8
HpyAV CCTTC 3 cut(s) 50, 74, 382
HpyCH4III ACNGT 3 cut(s) 225, 263, 368
HpyCH4V TGCA 2 cut(s) 97, 221
Hsp92II CATG 1 cut(s) 122
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 140, 258, 313
Lsp1109I GCAGC 1 cut(s) 190
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 1 cut(s) 389
MluCI AATT 3 cut(s) 103, 291, 398
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 4 cut(s) 8, 136, 143, 346
MroXI GAANNNNTTC 1 cut(s) 281
MseI TTAA 2 cut(s) 107, 406
MspA1I CMGCKG 1 cut(s) 203
NdeII GATC 1 cut(s) 24
NlaIII CATG 1 cut(s) 122
NspI RCATGY 1 cut(s) 122
PaeI GCATGC 1 cut(s) 122
PcsI WCGNNNNNNNCGW 1 cut(s) 145
PdmI GAANNNNTTC 1 cut(s) 281
PkrI GCNGC 1 cut(s) 205
PsiI TTATAA 1 cut(s) 195
PspFI CCCAGC 1 cut(s) 327
PspPI GGNCC 1 cut(s) 157
PstNI CAGNNNCTG 1 cut(s) 206
PvuII CAGCTG 1 cut(s) 203
SaqAI TTAA 2 cut(s) 107, 406
SatI GCNGC 1 cut(s) 204
Sau3AI GATC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 157
SetI ASST 7 cut(s) 154, 187, 193, 205, 329, 356, 393
SfcI CTRYAG 1 cut(s) 186
SmiI ATTTAAAT 1 cut(s) 108
SmlI CTYRAG 1 cut(s) 307
SmoI CTYRAG 1 cut(s) 307
SphI GCATGC 1 cut(s) 122
Sse9I AATT 3 cut(s) 103, 291, 398
SwaI ATTTAAAT 1 cut(s) 108
TaaI ACNGT 3 cut(s) 225, 263, 368
TaqI TCGA 1 cut(s) 114
TasI AATT 3 cut(s) 103, 291, 398
Tru1I TTAA 2 cut(s) 107, 406
Tru9I TTAA 2 cut(s) 107, 406
TscAI CASTG 3 cut(s) 104, 268, 373
TseI GCWGC 1 cut(s) 203
TspDTI ATGAA 2 cut(s) 69, 375
TspRI CASTG 3 cut(s) 104, 268, 373
XapI RAATTY 2 cut(s) 103, 398
XceI RCATGY 1 cut(s) 122
XmiI GTMKAC 1 cut(s) 7
XmnI GAANNNNTTC 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.