Rmu_sc0000888.1_g000013

S-adenosylmethionine-dependent methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000888.1
OG0000151
Physical Location & Seq
Forward (+)
51006 .. 51921
916 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000888.1_g000013.1.cds

Sequence Viewer

Length: 747 bp
atgcttttccagtccctccctcagaacaggcaataccatgcagccggtgtacctggttctttctacaaacaggtgttacctaatgcttccattaactttgcttactcttctactgccattcaatggctctctagagtaccaacagcagtagcagatagtaatagtcctgcgtggaacaaaggacacattcattactcaaatgccacagatgaagtaataagggcttacgaaactcaatatagtgatgacatggagagcttcctgcaagccagggcacaagagattgtgtacggaggattaattgtccttacatttccaggccgccacagtgacacccctcattctgatgctctgccaaacatggtcttacagcttttaggagcctccctcatggacttggttagaaagggattagttagcgaagagaaggtagattcatttaacatacctgtgtattcaatgtctcccaaagaactagcagctgctgtagaaagaaatggatgttttagcatagagatggtggcagacttgcttgttcccccggtagatgacactagctcaatgccacaactaattgcctctcacattagagctggcatggaggggatattgaagcagcaatttggagaggaacttatagatgagctcttcgatttgtatcaggaaaaatgtgaagagcatatctccaccacagacacagggaagccagttaacttccttgtggtgcttagacgcaaggaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

248

Amino Acids

27.6

Weight (kDa)

4.91

Isoelectric Point (pI)

57.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000151)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G37970 AT5G37990 AT5G38100 AT5G38100 AT5G38100 AT5G38100 AT5G38780 AT5G38780
fragaria_vesca FvH4_4g07940 FvH4_4g07950 FvH4_5g16970 FvH4_7g18490
malus_domestica MD02G1312100.v1.1 MD02G1312500.v1.1 MD05G1007900.v1.1 MD06G1223300.v1.1 MD06G1223500.v1.1 MD06G1223600.v1.1 MD06G1223700.v1.1 MD06G1223800.v1.1 MD06G1227300.v1.1 MD09G1253900.v1.1 MD09G1254000.v1.1 MD09G1254100.v1.1 MD09G1254200.v1.1 MD09G1254300.v1.1 MD10G1005200.v1.1 MD10G1005900.v1.1 MD14G1232400.v1.1 MD14G1232700.v1.1 MD14G1232800.v1.1 MD14G1232900.v1.1 MD14G1233000.v1.1 MD15G1255300.v1.1
prunus_persica Prupe.5G228400_v2.0.a1 Prupe.5G228500_v2.0.a1 Prupe.5G228500_v2.0.a1 Prupe.5G228500_v2.0.a1 Prupe.5G228600_v2.0.a1 Prupe.5G228700_v2.0.a1 Prupe.5G228800_v2.0.a1 Prupe.5G228900_v2.0.a1 Prupe.5G229000_v2.0.a1 Prupe.8G008300_v2.0.a1
pyrus_communis pycom02g26200 pycom02g26220 pycom05g00410 pycom06g19910 pycom06g19920 pycom06g19930 pycom06g19940 pycom06g20380 pycom09g16970 pycom09g16990 pycom09g17000 pycom10g00420 pycom14g19370 pycom14g19380 pycom14g19420 pycom14g19430 pycom15g22380 pycom15g22390
rosa_chinensis RchiOBHm_Chr1g0327241 RchiOBHm_Chr1g0327261 RchiOBHm_Chr2g0128631 RchiOBHm_Chr2g0137031 RchiOBHm_Chr3g0486031 RchiOBHm_Chr3g0486051 RchiOBHm_Chr3g0486091 RchiOBHm_Chr4g0400921 RchiOBHm_Chr4g0400971 RchiOBHm_Chr4g0400991 RchiOBHm_Chr7g0178281 RchiOBHm_Chr7g0178301 RchiOBHm_Chr7g0178321 RchiOBHm_Chr7g0178951 RchiOBHm_Chr7g0178961 RchiOBHm_Chr7g0178971 RchiOBHm_Chr7g0178991 RchiOBHm_Chr7g0179001 RchiOBHm_Chr7g0179021 RchiOBHm_Chr7g0179031 RchiOBHm_Chr7g0179041 RchiOBHm_Chr7g0179051 RchiOBHm_Chr7g0187641 RchiOBHm_Chr7g0201881 RchiOBHm_Chr7g0201901
rosa_laevigata RLG00000005390 RLG00000005391 RLG00000005392 RLG00000005394 RLG00000005456 RLG00000009163 RLG00000009164 RLG00000019598 RLG00000023105 RLG00000030028
rosa_multiflora Rmu_co8337425.1_g000001 Rmu_sc0000795.1_g000125 Rmu_sc0000837.1_g000085 Rmu_sc0000888.1_g000008 Rmu_sc0000888.1_g000010 Rmu_sc0000888.1_g000011 Rmu_sc0000888.1_g000013 Rmu_sc0001021.1_g000003 Rmu_sc0001021.1_g000004 Rmu_sc0001021.1_g000006 Rmu_sc0001374.1_g000046 Rmu_sc0002026.1_g000007 Rmu_sc0002026.1_g000019 Rmu_sc0003465.1_g000046 Rmu_sc0004483.1_g000006 Rmu_sc0006229.1_g000002 Rmu_sc0006736.1_g000019 Rmu_sc0006736.1_g000027 Rmu_sc0007073.1_g000003 Rmu_sc0036373.1_g000001 Rmu_ssc0000009.1_g000007
rosa_roxburghii Rroxscaffold_2G00107760 Rroxscaffold_2G00115440 Rroxscaffold_2G00115920 Rroxscaffold_3G00255030 Rroxscaffold_3G00267200 Rroxscaffold_3G00274440 Rroxscaffold_3G00274450 Rroxscaffold_3G00274480 Rroxscaffold_4G00322940 Rroxscaffold_4G00322950 Rroxscaffold_4G00322980 Rroxscaffold_4G00323000 Rroxscaffold_4G00323020 Rroxscaffold_5G00345860 Rroxscaffold_5G00345890 Rroxscaffold_5G00345920 Rroxscaffold_6G00396060 Rroxscaffold_6G00396070
rosa_rugosa Rorug01G0064700 Rorug01G0064700 Rorug01G0064700 Rorug01G0064700 Rorug01G0064800 Rorug01G0297000 Rorug02G0279500 Rorug02G0337300 Rorug03G0223300 Rorug03G0223400 Rorug03G0223400 Rorug03G0223400 Rorug03G0223400 Rorug03G0223500 Rorug03G0223600 Rorug04G0027400 Rorug04G0027500 Rorug04G0027600 Rorug06G0420600 Rorug06G0420600 Rorug06G0483400 Rorug07G0066400 Rorug07G0066600
rosa_samantha Rh1AG081900 Rh1AG082300 Rh1AG082400 Rh1AG305600 Rh2BG340800 Rh2BG393000 Rh3BG308300 Rh4CG113300 Rh4CG113700 Rh7CG020600 Rh7CG020700 Rh7CG020800 Rh7CG021000 Rh7CG088900 Rh7CG204900
rosa_wichuraiana Rw0G002670 Rw0G014940 Rw0G021450 Rw1G006470 Rw1G006490 Rw2G026880 Rw2G027140 Rw2G031610 Rw3G024210 Rw3G024220 Rw7G001620 Rw7G001630 Rw7G001640 Rw7G001650 Rw7G016930 Rw7G016950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 123
AciI CCGC 1 cut(s) 322
AfaI GTAC 3 cut(s) 51, 138, 290
AfiI CCNNNNNNNGG 1 cut(s) 123
AgsI TTSAA 3 cut(s) 122, 459, 613
AjnI CCWGG 3 cut(s) 52, 269, 316
AluBI AGCT 6 cut(s) 258, 373, 482, 558, 593, 646
AluI AGCT 6 cut(s) 258, 373, 482, 558, 593, 646
Alw21I GWGCWC 1 cut(s) 648
Alw26I GTCTC 1 cut(s) 468
AlwNI CAGNNNCTG 1 cut(s) 485
AoxI GGCC 1 cut(s) 319
ApeKI GCWGC 4 cut(s) 41, 479, 482, 616
AseI ATTAAT 1 cut(s) 299
AsuC2I CCSGG 1 cut(s) 542
BaeGI GKGCMC 1 cut(s) 277
BanII GRGCYC 1 cut(s) 648
Bbv12I GWGCWC 1 cut(s) 648
BbvI GCAGC 4 cut(s) 53, 469, 491, 628
BccI CCATC 1 cut(s) 511
BciT130I CCWGG 3 cut(s) 54, 271, 318
BcnI CCSGG 1 cut(s) 542
BcoDI GTCTC 1 cut(s) 468
BfaI CTAG 3 cut(s) 132, 476, 555
BfmI CTRYAG 1 cut(s) 486
BisI GCNGC 5 cut(s) 42, 322, 480, 483, 617
BlsI GCNGC 5 cut(s) 43, 323, 481, 484, 618
Bme1390I CCNGG 4 cut(s) 54, 271, 318, 542
BmiI GGNNCC 1 cut(s) 382
BmrFI CCNGG 4 cut(s) 54, 271, 318, 542
BmsI GCATC 1 cut(s) 337
BplI GAGNNNNNCTC 4 cut(s) 372, 404, 668, 700
BpuMI CCSGG 1 cut(s) 542
BsaBI GATNNNNATC 1 cut(s) 657
BsaJI CCNNGG 2 cut(s) 270, 540
Bsc4I CCNNNNNNNGG 1 cut(s) 123
Bse118I RCCGGY 1 cut(s) 44
Bse1I ACTGG 2 cut(s) 10, 707
Bse8I GATNNNNATC 1 cut(s) 657
BseBI CCWGG 3 cut(s) 54, 271, 318
BseDI CCNNGG 2 cut(s) 270, 540
BseGI GGATG 1 cut(s) 506
BseJI GATNNNNATC 1 cut(s) 657
BseLI CCNNNNNNNGG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 35
BseNI ACTGG 2 cut(s) 10, 707
BseSI GKGCMC 1 cut(s) 277
BseXI GCAGC 4 cut(s) 53, 469, 491, 628
BshFI GGCC 1 cut(s) 321
BsiHKAI GWGCWC 1 cut(s) 648
BsiSI CCGG 2 cut(s) 45, 542
BslI CCNNNNNNNGG 1 cut(s) 123
BsmAI GTCTC 1 cut(s) 468
BsnI GGCC 1 cut(s) 321
Bsp1286I GDGCHC 2 cut(s) 277, 648
BspACI CCGC 1 cut(s) 322
BspANI GGCC 1 cut(s) 321
BspCNI CTCAG 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 382
BspQI GCTCTTC 2 cut(s) 653, 669
BsrFI RCCGGY 1 cut(s) 44
BsrI ACTGG 2 cut(s) 10, 707
BssAI RCCGGY 1 cut(s) 44
BssECI CCNNGG 2 cut(s) 270, 540
Bst2UI CCWGG 3 cut(s) 54, 271, 318
Bst4CI ACNGT 1 cut(s) 329
Bst6I CTCTTC 4 cut(s) 112, 417, 653, 669
BstC8I GCNNGC 2 cut(s) 267, 595
BstDEI CTNAG 2 cut(s) 21, 728
BstF5I GGATG 1 cut(s) 506
BstMAI GTCTC 1 cut(s) 468
BstNI CCWGG 3 cut(s) 54, 271, 318
BstSCI CCNGG 4 cut(s) 52, 269, 316, 540
BstSFI CTRYAG 1 cut(s) 486
BstSLI GKGCMC 1 cut(s) 277
BstV1I GCAGC 4 cut(s) 53, 469, 491, 628
BsuRI GGCC 1 cut(s) 321
BtsCI GGATG 1 cut(s) 506
BtsIMutI CAGTG 1 cut(s) 334
Cac8I GCNNGC 2 cut(s) 267, 595
CaiI CAGNNNCTG 1 cut(s) 485
Cfr10I RCCGGY 1 cut(s) 44
CseI GACGC 1 cut(s) 741
CsiI ACCWGGT 1 cut(s) 52
Csp6I GTAC 3 cut(s) 50, 137, 289
CviAII CATG 5 cut(s) 38, 250, 361, 391, 598
CviQI GTAC 3 cut(s) 50, 137, 289
DdeI CTNAG 2 cut(s) 21, 728
Eam1104I CTCTTC 4 cut(s) 112, 417, 653, 669
EarI CTCTTC 4 cut(s) 112, 417, 653, 669
Ecl136II GAGCTC 1 cut(s) 646
Eco24I GRGCYC 1 cut(s) 648
Eco53kI GAGCTC 1 cut(s) 646
EcoICRI GAGCTC 1 cut(s) 646
EcoRII CCWGG 3 cut(s) 52, 269, 316
EcoT38I GRGCYC 1 cut(s) 648
FaeI CATG 5 cut(s) 41, 253, 364, 394, 601
FatI CATG 5 cut(s) 37, 249, 360, 390, 597
Fnu4HI GCNGC 5 cut(s) 42, 322, 480, 483, 617
FokI GGATG 1 cut(s) 513
FriOI GRGCYC 1 cut(s) 648
Fsp4HI GCNGC 5 cut(s) 42, 322, 480, 483, 617
FspBI CTAG 3 cut(s) 132, 476, 555
GluI GCNGC 5 cut(s) 42, 322, 480, 483, 617
HaeIII GGCC 1 cut(s) 321
HapII CCGG 2 cut(s) 45, 542
HgaI GACGC 1 cut(s) 741
Hin1II CATG 5 cut(s) 41, 253, 364, 394, 601
HincII GTYRAC 1 cut(s) 712
HindII GTYRAC 1 cut(s) 712
HinfI GANTC 1 cut(s) 434
HpaI GTTAAC 1 cut(s) 712
HpaII CCGG 2 cut(s) 45, 542
Hpy166II GTNNAC 3 cut(s) 50, 289, 712
Hpy188I TCNGA 2 cut(s) 24, 346
Hpy188III TCNNGA 2 cut(s) 132, 662
Hpy8I GTNNAC 3 cut(s) 50, 289, 712
HpyAV CCTTC 1 cut(s) 421
HpyCH4III ACNGT 1 cut(s) 329
HpyCH4V TGCA 2 cut(s) 41, 265
HpyF3I CTNAG 2 cut(s) 21, 728
Hsp92II CATG 5 cut(s) 41, 253, 364, 394, 601
KspAI GTTAAC 1 cut(s) 712
LguI GCTCTTC 2 cut(s) 653, 669
LmnI GCTCC 1 cut(s) 380
Lsp1109I GCAGC 4 cut(s) 53, 469, 491, 628
LweI GCATC 1 cut(s) 337
MabI ACCWGGT 1 cut(s) 52
MaeI CTAG 3 cut(s) 132, 476, 555
MaeIII GTNAC 2 cut(s) 75, 329
MboII GAAGA 4 cut(s) 99, 434, 640, 686
MhlI GDGCHC 2 cut(s) 277, 648
MluCI AATT 3 cut(s) 300, 573, 620
MnlI CCTC 9 cut(s) 26, 30, 287, 348, 394, 398, 589, 595, 622
MseI TTAA 4 cut(s) 93, 299, 441, 711
MslI CAYNNNNRTG 3 cut(s) 345, 449, 515
MspA1I CMGCKG 1 cut(s) 482
MspI CCGG 2 cut(s) 45, 542
MspR9I CCNGG 4 cut(s) 54, 271, 318, 542
MvaI CCWGG 3 cut(s) 54, 271, 318
NciI CCSGG 1 cut(s) 542
NlaIII CATG 5 cut(s) 41, 253, 364, 394, 601
NlaIV GGNNCC 1 cut(s) 382
NmuCI GTSAC 1 cut(s) 329
PciSI GCTCTTC 2 cut(s) 653, 669
PfeI GAWTC 1 cut(s) 434
PflMI CCANNNNNTGG 1 cut(s) 123
PkrI GCNGC 5 cut(s) 43, 323, 481, 484, 618
PshBI ATTAAT 1 cut(s) 299
Psp124BI GAGCTC 1 cut(s) 648
Psp6I CCWGG 3 cut(s) 52, 269, 316
PspGI CCWGG 3 cut(s) 52, 269, 316
PspN4I GGNNCC 1 cut(s) 382
PsrI GAACNNNNNNTAC 2 cut(s) 17, 49
PstNI CAGNNNCTG 1 cut(s) 485
PvuII CAGCTG 1 cut(s) 482
RsaI GTAC 3 cut(s) 51, 138, 290
RsaNI GTAC 3 cut(s) 50, 137, 289
RseI CAYNNNNRTG 3 cut(s) 345, 449, 515
SacI GAGCTC 1 cut(s) 648
SapI GCTCTTC 2 cut(s) 653, 669
SaqAI TTAA 4 cut(s) 93, 299, 441, 711
SatI GCNGC 5 cut(s) 42, 322, 480, 483, 617
ScrFI CCNGG 4 cut(s) 54, 271, 318, 542
SduI GDGCHC 2 cut(s) 277, 648
SexAI ACCWGGT 1 cut(s) 52
SfaNI GCATC 1 cut(s) 337
SfcI CTRYAG 1 cut(s) 486
SmiMI CAYNNNNRTG 3 cut(s) 345, 449, 515
Sse9I AATT 3 cut(s) 300, 573, 620
SsiI CCGC 1 cut(s) 322
SspMI CTAG 3 cut(s) 132, 476, 555
SstI GAGCTC 1 cut(s) 648
StyD4I CCNGG 4 cut(s) 52, 269, 316, 540
TaaI ACNGT 1 cut(s) 329
TaqI TCGA 1 cut(s) 651
TasI AATT 3 cut(s) 300, 573, 620
TauI GCSGC 1 cut(s) 324
TfiI GAWTC 1 cut(s) 434
Tru1I TTAA 4 cut(s) 93, 299, 441, 711
Tru9I TTAA 4 cut(s) 93, 299, 441, 711
TscAI CASTG 1 cut(s) 334
TseFI GTSAC 1 cut(s) 329
TseI GCWGC 4 cut(s) 41, 479, 482, 616
Tsp45I GTSAC 1 cut(s) 329
TspDTI ATGAA 3 cut(s) 179, 225, 426
TspGWI ACGGA 1 cut(s) 306
TspRI CASTG 1 cut(s) 334
Van91I CCANNNNNTGG 1 cut(s) 123
VspI ATTAAT 1 cut(s) 299
XbaI TCTAGA 1 cut(s) 131
XspI CTAG 3 cut(s) 132, 476, 555
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.