Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001926.1

Orthogroup ID

OG0000285

Physical Location & Seq

Genomic Coordinates Forward (+)

38243 .. 39388

Gene Structure 1146 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001926.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1146 bp

atgtcagagttgctgtttcttgatctctcaaggaattatttctctggaaatattcccagggattggacgggtttgcaagatttggaggtcatagacttttcaaataacaatctatctggtgaaatcccaagcaccatgtgctcccaactaccatcactcaaatggttgagactaagcaacaacaatctttctgggaatcttgagtcgtctttgcaaacttgcagaaatctctctgcacttgatctgacaggaaacaacttttctggaaccataccagattgtattggagaaaaccttcatacattgtcttatttacttctaggagccaacaagttcataggaaatattcctcatcaattatgcgatctctcctctcttcaggttttagacctttcccaaaataatatatctggctccattcctgcatgtcttggtggtttgaaacaaatgacaacaatagatggcttgcttgggaacagctgggttagcaacttgacgatctctttgaggctttatgatcgtatgcatattgacttaaatgtgaaaggagtagaatatgaatatattgatgatatcatagcactcattaaaaagttagacctgtcaagtaataatctatggggagaaataccagaagaggtcaaaaatctcatggctttgggtagcttgaacttatcccataaccatttgacaggaaagataccagagggtatcggaagcttacataagttagaagcacttgacctctctagtaaccatctttggggtttaattccttcaagcatgacctctatgacttcactaagcaaattgaatttgtcattcaacaacttctctgggccaatcccatcagccaaccaattcctcaccttcaatgacccaacctcatttgaaggaaactcaggactttgcggacctccattgccaacccaatgcagttcagttaatgatccagctgtgaaggttgacgaagatgaagaagataagtatggaaaattatggttctatgcaagcacatcattggggttcattgtaggattttgggttgcttttggaagtttggtgataaagaggtcatggagacatgcttacttccagtttcttgacaatatgaaagacaagctttgcttctgtttttggaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003002 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0007275 GO:0007389 GO:0008150 GO:0008152 GO:0009719 GO:0009725 GO:0009733 GO:0009734 GO:0009741 GO:0009742 GO:0009755 GO:0009987 GO:0010033 GO:0010051 GO:0010232 GO:0010233 GO:0010305 GO:0014070 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0023052 GO:0032501 GO:0032502 GO:0032870 GO:0033993 GO:0036211 GO:0038023 GO:0042221 GO:0043170 GO:0043401 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0048545 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051716 GO:0060089 GO:0065007 GO:0070887 GO:0071310 GO:0071365 GO:0071367 GO:0071383 GO:0071396 GO:0071407 GO:0071495 GO:0071704 GO:0140096 GO:1901564 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

381

Amino Acids

42.22

Weight (kDa)

5.0

Isoelectric Point (pI)

35.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000285)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47885
fragaria_vesca	FvH4_3g09550 FvH4_4g32560
malus_domestica	MD01G1172200.v1.1
rosa_chinensis	RchiOBHm_Chr1g0353911 RchiOBHm_Chr1g0354141 RchiOBHm_Chr1g0354151 RchiOBHm_Chr1g0354161 RchiOBHm_Chr1g0354191 RchiOBHm_Chr1g0354201 RchiOBHm_Chr1g0354221 RchiOBHm_Chr1g0354271 RchiOBHm_Chr1g0354301 RchiOBHm_Chr1g0354321 RchiOBHm_Chr1g0354371 RchiOBHm_Chr1g0354401 RchiOBHm_Chr1g0354411 RchiOBHm_Chr1g0354451 RchiOBHm_Chr1g0354551 RchiOBHm_Chr1g0359231 RchiOBHm_Chr3g0470501 RchiOBHm_Chr4g0440611 RchiOBHm_Chr4g0440631 RchiOBHm_Chr4g0441421 RchiOBHm_Chr4g0441431 RchiOBHm_Chr5g0015191 RchiOBHm_Chr5g0022441 RchiOBHm_Chr7g0207081
rosa_laevigata	RLG00000009355 RLG00000009356 RLG00000023813 RLG00000024262 RLG00000028199 RLG00000028200 RLG00000028204 RLG00000028209 RLG00000028211 RLG00000028214 RLG00000028216 RLG00000028220 RLG00000028221 RLG00000028223 RLG00000028224 RLG00000028886 RLG00000029706 RLG00000032176
rosa_multiflora	Rmu_co8366321.1_g000001 Rmu_sc0001926.1_g000008 Rmu_sc0001926.1_g000009 Rmu_sc0002115.1_g000006 Rmu_sc0002115.1_g000007 Rmu_sc0002209.1_g000020 Rmu_sc0002737.1_g000005 Rmu_sc0002737.1_g000009 Rmu_sc0002737.1_g000015 Rmu_sc0002737.1_g000016 Rmu_sc0002737.1_g000018 Rmu_sc0002930.1_g000003 Rmu_sc0002930.1_g000005 Rmu_sc0003292.1_g000004 Rmu_sc0003360.1_g000004 Rmu_sc0003360.1_g000005 Rmu_sc0003381.1_g000013 Rmu_sc0004299.1_g000001 Rmu_sc0007159.1_g000001 Rmu_sc0007159.1_g000007 Rmu_sc0009777.1_g000002 Rmu_sc0010755.1_g000002 Rmu_sc0012353.1_g000001 Rmu_sc0012562.1_g000003 Rmu_sc0012562.1_g000004 Rmu_sc0012562.1_g000006 Rmu_sc0012562.1_g000013 Rmu_sc0012562.1_g000021 Rmu_sc0015525.1_g000001 Rmu_sc0015525.1_g000005 Rmu_sc0018378.1_g000001 Rmu_sc0022127.1_g000002 Rmu_sc0022144.1_g000002 Rmu_sc0035791.1_g000001
rosa_roxburghii	Rroxscaffold_1G00056680 Rroxscaffold_1G00061360 Rroxscaffold_3G00236900 Rroxscaffold_4G00300940 Rroxscaffold_4G00301040 Rroxscaffold_4G00301050 Rroxscaffold_4G00301070 Rroxscaffold_4G00301100 Rroxscaffold_4G00301110 Rroxscaffold_4G00301930 Rroxscaffold_4G00301940 Rroxscaffold_4G00301950 Rroxscaffold_7G00202690
rosa_rugosa	Rorug01G0242000 Rorug01G0242100 Rorug01G0242200 Rorug01G0242300 Rorug01G0242700 Rorug01G0242900 Rorug01G0243000 Rorug03G0109600 Rorug03G0109700 Rorug04G0327000 Rorug04G0333500 Rorug04G0333600 Rorug05G0024600 RorugPtG0003000
rosa_samantha	Rh1AG253200 Rh1AG253400 Rh1BG225200 Rh1CG177100 Rh1CG234500 Rh1CG237000 Rh1DG252000 Rh1DG252400 Rh1DG252900 Rh3CG085900 Rh4BG399300 Rh4DG391900
rosa_wichuraiana	Rw1G015760 Rw1G022030 Rw1G022100 Rw1G022120 Rw1G022230 Rw5G010290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	63
AciI	CCGC	1 cut(s)	912
AclWI	GGATC	1 cut(s)	944
AcsI	RAATTY	1 cut(s)	814
AcuI	CTGAAG	1 cut(s)	362
AdeI	CACNNNGTG	1 cut(s)	138
AfiI	CCNNNNNNNGG	2 cut(s)	63, 763
AgsI	TTSAA	8 cut(s)	102, 442, 670, 780, 814, 826, 874, 893
AjnI	CCWGG	1 cut(s)	56
AluBI	AGCT	5 cut(s)	480, 666, 720, 956, 1123
AluI	AGCT	5 cut(s)	480, 666, 720, 956, 1123
Alw21I	GWGCWC	1 cut(s)	143
Alw26I	GTCTC	2 cut(s)	163, 1075
AlwI	GGATC	1 cut(s)	944
AoxI	GGCC	1 cut(s)	839
ApoI	RAATTY	1 cut(s)	814
ArsI	GACNNNNNNTTYG	2 cut(s)	487, 519
Asp700I	GAANNNNTTC	2 cut(s)	38, 294
AspS9I	GGNCC	2 cut(s)	839, 914
AsuHPI	GGTGA	3 cut(s)	131, 859, 1075
AvaII	GGWCC	1 cut(s)	914
Bbv12I	GWGCWC	1 cut(s)	143
BccI	CCATC	4 cut(s)	160, 455, 765, 856
BciT130I	CCWGG	1 cut(s)	58
BcoDI	GTCTC	2 cut(s)	163, 1075
BfaI	CTAG	2 cut(s)	320, 750
Bme1390I	CCNGG	1 cut(s)	58
Bme18I	GGWCC	1 cut(s)	914
BmgT120I	GGNCC	2 cut(s)	839, 914
BmiI	GGNNCC	3 cut(s)	268, 325, 415
BmrFI	CCNGG	1 cut(s)	58
BpuEI	CTTGAG	2 cut(s)	13, 221
BsaJI	CCNNGG	2 cut(s)	56, 57
Bsc4I	CCNNNNNNNGG	2 cut(s)	63, 763
Bse1I	ACTGG	1 cut(s)	1096
Bse3DI	GCAATG	1 cut(s)	920
BseBI	CCWGG	1 cut(s)	58
BseDI	CCNNGG	2 cut(s)	56, 57
BseLI	CCNNNNNNNGG	2 cut(s)	63, 763
BseMI	GCAATG	1 cut(s)	920
BseMII	CTCAG	1 cut(s)	915
BseNI	ACTGG	1 cut(s)	1096
BseRI	GAGGAG	1 cut(s)	361
BseYI	CCCAGC	1 cut(s)	480
BsgI	GTGCAG	1 cut(s)	219
BshFI	GGCC	1 cut(s)	841
BsiHKAI	GWGCWC	1 cut(s)	143
BslI	CCNNNNNNNGG	2 cut(s)	63, 763
BsmAI	GTCTC	2 cut(s)	163, 1075
BsnI	GGCC	1 cut(s)	841
Bsp1286I	GDGCHC	1 cut(s)	143
Bsp143I	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
BspACI	CCGC	1 cut(s)	912
BspANI	GGCC	1 cut(s)	841
BspCNI	CTCAG	1 cut(s)	914
BspLI	GGNNCC	3 cut(s)	268, 325, 415
BspPI	GGATC	1 cut(s)	944
BsrDI	GCAATG	1 cut(s)	920
BsrI	ACTGG	1 cut(s)	1096
BssECI	CCNNGG	2 cut(s)	56, 57
BssMI	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
Bst2UI	CCWGG	1 cut(s)	58
Bst6I	CTCTTC	2 cut(s)	381, 630
BstAPI	GCANNNNNTGC	1 cut(s)	138
BstC8I	GCNNGC	2 cut(s)	467, 1012
BstDEI	CTNAG	3 cut(s)	173, 803, 901
BstKTI	GATC	6 cut(s)	25, 244, 367, 501, 520, 952
BstMAI	GTCTC	2 cut(s)	163, 1075
BstMBI	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
BstMWI	GCNNNNNNNGC	2 cut(s)	138, 486
BstNI	CCWGG	1 cut(s)	58
BstNSI	RCATGY	2 cut(s)	429, 1088
BstSCI	CCNGG	1 cut(s)	56
BsuRI	GGCC	1 cut(s)	841
Cac8I	GCNNGC	2 cut(s)	467, 1012
Cfr13I	GGNCC	2 cut(s)	839, 914
CviAII	CATG	6 cut(s)	136, 426, 652, 784, 1077, 1085
DdeI	CTNAG	3 cut(s)	173, 803, 901
DpnI	GATC	6 cut(s)	24, 243, 366, 500, 519, 951
DpnII	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
DraIII	CACNNNGTG	1 cut(s)	138
Eam1104I	CTCTTC	2 cut(s)	381, 630
EarI	CTCTTC	2 cut(s)	381, 630
Eco32I	GATATC	1 cut(s)	574
Eco47I	GGWCC	1 cut(s)	914
Eco57I	CTGAAG	1 cut(s)	362
EcoRII	CCWGG	1 cut(s)	56
EcoRV	GATATC	1 cut(s)	574
EcoT22I	ATGCAT	1 cut(s)	528
FaeI	CATG	6 cut(s)	139, 429, 655, 787, 1080, 1088
FalI	AAGNNNNNCTT	4 cut(s)	1107, 1139, 1112, 1144
FatI	CATG	6 cut(s)	135, 425, 651, 783, 1076, 1084
FspBI	CTAG	2 cut(s)	320, 750
GsaI	CCCAGC	1 cut(s)	484
HaeIII	GGCC	1 cut(s)	841
Hin1II	CATG	6 cut(s)	139, 429, 655, 787, 1080, 1088
HincII	GTYRAC	1 cut(s)	967
HindII	GTYRAC	1 cut(s)	967
HindIII	AAGCTT	2 cut(s)	718, 1121
HinfI	GANTC	2 cut(s)	196, 203
HphI	GGTGA	3 cut(s)	131, 859, 1075
Hpy166II	GTNNAC	1 cut(s)	967
Hpy188I	TCNGA	3 cut(s)	7, 246, 716
Hpy188III	TCNNGA	6 cut(s)	20, 45, 200, 264, 903, 1103
Hpy8I	GTNNAC	1 cut(s)	967
HpyAV	CCTTC	5 cut(s)	305, 786, 880, 887, 955
HpyCH4V	TGCA	8 cut(s)	76, 214, 222, 236, 425, 526, 936, 1010
HpyF10VI	GCNNNNNNNGC	2 cut(s)	138, 486
HpyF3I	CTNAG	3 cut(s)	173, 803, 901
Hsp92II	CATG	6 cut(s)	139, 429, 655, 787, 1080, 1088
Kzo9I	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
LmnI	GCTCC	3 cut(s)	146, 323, 419
MaeI	CTAG	2 cut(s)	320, 750
MaeIII	GTNAC	1 cut(s)	752
MalI	GATC	6 cut(s)	24, 243, 366, 500, 519, 951
MboI	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
MboII	GAAGA	5 cut(s)	368, 647, 983, 989, 992
MhlI	GDGCHC	1 cut(s)	143
MluCI	AATT	7 cut(s)	34, 356, 771, 809, 814, 860, 995
MlyI	GAGTC	1 cut(s)	212
Mph1103I	ATGCAT	1 cut(s)	528
MroXI	GAANNNNTTC	2 cut(s)	38, 294
MseI	TTAA	4 cut(s)	536, 588, 770, 945
MslI	CAYNNNNRTG	1 cut(s)	160
MspA1I	CMGCKG	2 cut(s)	480, 956
MspR9I	CCNGG	1 cut(s)	58
MvaI	CCWGG	1 cut(s)	58
MwoI	GCNNNNNNNGC	2 cut(s)	138, 486
NdeII	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
NlaIII	CATG	6 cut(s)	139, 429, 655, 787, 1080, 1088
NlaIV	GGNNCC	3 cut(s)	268, 325, 415
NsiI	ATGCAT	1 cut(s)	528
NspI	RCATGY	2 cut(s)	429, 1088
PasI	CCCWGGG	1 cut(s)	57
PdmI	GAANNNNTTC	2 cut(s)	38, 294
PfeI	GAWTC	1 cut(s)	196
PflMI	CCANNNNNTGG	1 cut(s)	63
PleI	GAGTC	1 cut(s)	211
PpsI	GAGTC	1 cut(s)	211
Psp6I	CCWGG	1 cut(s)	56
PspFI	CCCAGC	1 cut(s)	480
PspGI	CCWGG	1 cut(s)	56
PspN4I	GGNNCC	3 cut(s)	268, 325, 415
PspPI	GGNCC	2 cut(s)	839, 914
PvuII	CAGCTG	2 cut(s)	480, 956
RseI	CAYNNNNRTG	1 cut(s)	160
SaqAI	TTAA	4 cut(s)	536, 588, 770, 945
Sau3AI	GATC	6 cut(s)	22, 241, 364, 498, 517, 949
Sau96I	GGNCC	2 cut(s)	839, 914
SchI	GAGTC	1 cut(s)	212
ScrFI	CCNGG	1 cut(s)	58
SduI	GDGCHC	1 cut(s)	143
SinI	GGWCC	1 cut(s)	914
SmiMI	CAYNNNNRTG	1 cut(s)	160
SmlI	CTYRAG	2 cut(s)	28, 200
SmoI	CTYRAG	2 cut(s)	28, 200
Sse9I	AATT	7 cut(s)	34, 356, 771, 809, 814, 860, 995
SsiI	CCGC	1 cut(s)	912
SspI	AATATT	2 cut(s)	52, 346
SspMI	CTAG	2 cut(s)	320, 750
StyD4I	CCNGG	1 cut(s)	56
TasI	AATT	7 cut(s)	34, 356, 771, 809, 814, 860, 995
TfiI	GAWTC	1 cut(s)	196
Tru1I	TTAA	4 cut(s)	536, 588, 770, 945
Tru9I	TTAA	4 cut(s)	536, 588, 770, 945
TspDTI	ATGAA	6 cut(s)	287, 325, 573, 990, 1018, 1127
Van91I	CCANNNNNTGG	1 cut(s)	63
VpaK11BI	GGWCC	1 cut(s)	914
XapI	RAATTY	1 cut(s)	814
XceI	RCATGY	2 cut(s)	429, 1088
XcmI	CCANNNNNNNNNTGG	1 cut(s)	159
XmnI	GAANNNNTTC	2 cut(s)	38, 294
XspI	CTAG	2 cut(s)	320, 750
Zsp2I	ATGCAT	1 cut(s)	528

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.