Rmu_sc0002115.1_g000006

regulation of response to stimulus

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002115.1
Physical Location & Seq
Reverse (-)
27461 .. 28459
999 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002115.1_g000006.1.cds

Sequence Viewer

Length: 999 bp
atgtgctcacaactacctaggcttttttggttgaaattaagccaaaacaatctttctggggagctcagtccatccttacgagattgtgcaacactatttacgcttgatctcggagggaaccgaatgtctggaacaatacctgaatgggtaggagaaaatctaacttctatgtcatttttacacctaggagccaacatcttcactgggaacattcctgaacaattatgtcaactccctcttaaggttttagacctttctcagaataacatactaggttctatccctaaatgtcttggcaatcttgaagtcatgaaagatgtgggtatcatgtttaagttaccatcctccttctcgcaaccaccaccgagtgtatatttggaattaattgtgaggggaagactatatgaatattctgatctagtaggtctgctgaggatcatagacctttcaagcaataatctatcaggagaaataccagaagagataacaaccttattttccttgaatttatcccaaaaccaactcataggaagaataccagagagtattggaagcttgagctgcttagaatctcttgacctctcgagtaaccatctttgtggtccaattcctctgagcatgacttctatgactgcattgagcagattgaacttatcatacaacaacttgtcggggcctattccatcagcgaaccaattccaaaccttaaatgacccaagcatatttgaagcaaacttgggactttgtgggaatccattaccaatacaatgctcagctttcaacgatggtgatgcacaagctaaagagaacacagttgaagatgaagatggttatgaaaatctatggttctatacaagcacagcatttggattcattgtgggattctgggttgtttttggcagtttggtgattaagaggtcctggagacatgcctatttccagtatcttgacaaaatgaaaaataggtgtgcaatggtattcaatttggacatggcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

332

Amino Acids

36.76

Weight (kDa)

4.74

Isoelectric Point (pI)

36.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000285)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47885
fragaria_vesca FvH4_3g09550 FvH4_4g32560
malus_domestica MD01G1172200.v1.1
rosa_chinensis RchiOBHm_Chr1g0353911 RchiOBHm_Chr1g0354141 RchiOBHm_Chr1g0354151 RchiOBHm_Chr1g0354161 RchiOBHm_Chr1g0354191 RchiOBHm_Chr1g0354201 RchiOBHm_Chr1g0354221 RchiOBHm_Chr1g0354271 RchiOBHm_Chr1g0354301 RchiOBHm_Chr1g0354321 RchiOBHm_Chr1g0354371 RchiOBHm_Chr1g0354401 RchiOBHm_Chr1g0354411 RchiOBHm_Chr1g0354451 RchiOBHm_Chr1g0354551 RchiOBHm_Chr1g0359231 RchiOBHm_Chr3g0470501 RchiOBHm_Chr4g0440611 RchiOBHm_Chr4g0440631 RchiOBHm_Chr4g0441421 RchiOBHm_Chr4g0441431 RchiOBHm_Chr5g0015191 RchiOBHm_Chr5g0022441 RchiOBHm_Chr7g0207081
rosa_laevigata RLG00000009355 RLG00000009356 RLG00000023813 RLG00000024262 RLG00000028199 RLG00000028200 RLG00000028204 RLG00000028209 RLG00000028211 RLG00000028214 RLG00000028216 RLG00000028220 RLG00000028221 RLG00000028223 RLG00000028224 RLG00000028886 RLG00000029706 RLG00000032176
rosa_multiflora Rmu_co8366321.1_g000001 Rmu_sc0001926.1_g000008 Rmu_sc0001926.1_g000009 Rmu_sc0002115.1_g000006 Rmu_sc0002115.1_g000007 Rmu_sc0002209.1_g000020 Rmu_sc0002737.1_g000005 Rmu_sc0002737.1_g000009 Rmu_sc0002737.1_g000015 Rmu_sc0002737.1_g000016 Rmu_sc0002737.1_g000018 Rmu_sc0002930.1_g000003 Rmu_sc0002930.1_g000005 Rmu_sc0003292.1_g000004 Rmu_sc0003360.1_g000004 Rmu_sc0003360.1_g000005 Rmu_sc0003381.1_g000013 Rmu_sc0004299.1_g000001 Rmu_sc0007159.1_g000001 Rmu_sc0007159.1_g000007 Rmu_sc0009777.1_g000002 Rmu_sc0010755.1_g000002 Rmu_sc0012353.1_g000001 Rmu_sc0012562.1_g000003 Rmu_sc0012562.1_g000004 Rmu_sc0012562.1_g000006 Rmu_sc0012562.1_g000013 Rmu_sc0012562.1_g000021 Rmu_sc0015525.1_g000001 Rmu_sc0015525.1_g000005 Rmu_sc0018378.1_g000001 Rmu_sc0022127.1_g000002 Rmu_sc0022144.1_g000002 Rmu_sc0035791.1_g000001
rosa_roxburghii Rroxscaffold_1G00056680 Rroxscaffold_1G00061360 Rroxscaffold_3G00236900 Rroxscaffold_4G00300940 Rroxscaffold_4G00301040 Rroxscaffold_4G00301050 Rroxscaffold_4G00301070 Rroxscaffold_4G00301100 Rroxscaffold_4G00301110 Rroxscaffold_4G00301930 Rroxscaffold_4G00301940 Rroxscaffold_4G00301950 Rroxscaffold_7G00202690
rosa_rugosa Rorug01G0242000 Rorug01G0242100 Rorug01G0242200 Rorug01G0242300 Rorug01G0242700 Rorug01G0242900 Rorug01G0243000 Rorug03G0109600 Rorug03G0109700 Rorug04G0327000 Rorug04G0333500 Rorug04G0333600 Rorug05G0024600 RorugPtG0003000
rosa_samantha Rh1AG253200 Rh1AG253400 Rh1BG225200 Rh1CG177100 Rh1CG234500 Rh1CG237000 Rh1DG252000 Rh1DG252400 Rh1DG252900 Rh3CG085900 Rh4BG399300 Rh4DG391900
rosa_wichuraiana Rw1G015760 Rw1G022030 Rw1G022100 Rw1G022120 Rw1G022230 Rw5G010290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 443
AcsI RAATTY 1 cut(s) 505
AdeI CACNNNGTG 1 cut(s) 368
AfiI CCNNNNNNNGG 1 cut(s) 241
AflII CTTAAG 1 cut(s) 239
AgsI TTSAA 9 cut(s) 34, 305, 450, 505, 649, 728, 781, 818, 982
AjnI CCWGG 1 cut(s) 920
AluBI AGCT 5 cut(s) 64, 555, 561, 776, 800
AluI AGCT 5 cut(s) 64, 555, 561, 776, 800
Alw21I GWGCWC 2 cut(s) 8, 66
Alw26I GTCTC 1 cut(s) 919
AlwI GGATC 1 cut(s) 443
Ama87I CYCGRG 1 cut(s) 583
AoxI GGCC 1 cut(s) 674
ApeKI GCWGC 1 cut(s) 561
ApoI RAATTY 1 cut(s) 505
AseI ATTAAT 1 cut(s) 383
Asp700I GAANNNNTTC 1 cut(s) 695
AspA2I CCTAGG 2 cut(s) 17, 184
AspS9I GGNCC 3 cut(s) 602, 674, 918
AsuHPI GGTGA 2 cut(s) 800, 919
AvaI CYCGRG 1 cut(s) 583
AvaII GGWCC 2 cut(s) 602, 918
AvrII CCTAGG 2 cut(s) 17, 184
BanII GRGCYC 1 cut(s) 66
BbsI GAAGAC 1 cut(s) 403
Bbv12I GWGCWC 2 cut(s) 8, 66
BbvCI CCTCAGC 1 cut(s) 431
BbvI GCAGC 1 cut(s) 548
BccI CCATC 6 cut(s) 79, 349, 600, 691, 779, 821
BcgI CGANNNNNNTGC 2 cut(s) 773, 807
BciT130I CCWGG 1 cut(s) 922
BcoDI GTCTC 1 cut(s) 919
BfaI CTAG 4 cut(s) 18, 185, 272, 419
BfrI CTTAAG 1 cut(s) 239
BisI GCNGC 1 cut(s) 562
BlnI CCTAGG 2 cut(s) 17, 184
BlpI GCTNAGC 1 cut(s) 772
BlsI GCNGC 1 cut(s) 563
Bme1390I CCNGG 1 cut(s) 922
Bme18I GGWCC 2 cut(s) 602, 918
BmeT110I CYCGRG 1 cut(s) 583
BmgT120I GGNCC 3 cut(s) 602, 674, 918
BmiI GGNNCC 3 cut(s) 119, 190, 675
BmrFI CCNGG 1 cut(s) 922
BmrI ACTGGG 1 cut(s) 213
BmsI GCATC 1 cut(s) 781
BmuI ACTGGG 1 cut(s) 213
BpiI GAAGAC 1 cut(s) 403
BpmI CTGGAG 1 cut(s) 943
Bpu10I CCTNAGC 1 cut(s) 431
Bpu1102I GCTNAGC 1 cut(s) 772
BpuEI CTTGAG 1 cut(s) 577
BsaJI CCNNGG 2 cut(s) 17, 184
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse1I ACTGG 2 cut(s) 208, 940
Bse3DI GCAATG 1 cut(s) 978
BseBI CCWGG 1 cut(s) 922
BseDI CCNNGG 2 cut(s) 17, 184
BseGI GGATG 2 cut(s) 71, 341
BseLI CCNNNNNNNGG 1 cut(s) 241
BseMI GCAATG 1 cut(s) 978
BseMII CTCAG 5 cut(s) 79, 272, 422, 605, 786
BseNI ACTGG 2 cut(s) 208, 940
BseXI GCAGC 1 cut(s) 548
BshFI GGCC 1 cut(s) 676
BsiHKAI GWGCWC 2 cut(s) 8, 66
BsiHKCI CYCGRG 1 cut(s) 583
BslFI GGGAC 1 cut(s) 753
BslI CCNNNNNNNGG 1 cut(s) 241
BsmAI GTCTC 1 cut(s) 919
BsmFI GGGAC 1 cut(s) 753
BsnI GGCC 1 cut(s) 676
BsoBI CYCGRG 1 cut(s) 583
Bsp1286I GDGCHC 2 cut(s) 8, 66
Bsp143I GATC 3 cut(s) 106, 415, 435
Bsp1720I GCTNAGC 1 cut(s) 772
BspANI GGCC 1 cut(s) 676
BspCNI CTCAG 5 cut(s) 78, 271, 423, 606, 785
BspHI TCATGA 1 cut(s) 309
BspLI GGNNCC 3 cut(s) 119, 190, 675
BspPI GGATC 1 cut(s) 443
BspTI CTTAAG 1 cut(s) 239
BsrDI GCAATG 1 cut(s) 978
BsrI ACTGG 2 cut(s) 208, 940
BssECI CCNNGG 2 cut(s) 17, 184
BssMI GATC 3 cut(s) 106, 415, 435
BssT1I CCWWGG 2 cut(s) 17, 184
Bst2UI CCWGG 1 cut(s) 922
Bst4CI ACNGT 1 cut(s) 814
Bst6I CTCTTC 1 cut(s) 474
BstAFI CTTAAG 1 cut(s) 239
BstDEI CTNAG 6 cut(s) 65, 258, 431, 565, 614, 772
BstF5I GGATG 2 cut(s) 71, 341
BstKTI GATC 3 cut(s) 109, 418, 438
BstMAI GTCTC 1 cut(s) 919
BstMBI GATC 3 cut(s) 106, 415, 435
BstMWI GCNNNNNNNGC 1 cut(s) 561
BstNI CCWGG 1 cut(s) 922
BstNSI RCATGY 1 cut(s) 932
BstSCI CCNGG 1 cut(s) 920
BstV1I GCAGC 1 cut(s) 548
BstV2I GAAGAC 1 cut(s) 403
BstXI CCANNNNNNTGG 1 cut(s) 599
BsuRI GGCC 1 cut(s) 676
BtsCI GGATG 2 cut(s) 71, 341
BtsIMutI CAGTG 1 cut(s) 201
CciI TCATGA 1 cut(s) 309
Cfr13I GGNCC 3 cut(s) 602, 674, 918
CviAII CATG 5 cut(s) 310, 328, 619, 929, 991
DdeI CTNAG 6 cut(s) 65, 258, 431, 565, 614, 772
DpnI GATC 3 cut(s) 108, 417, 437
DpnII GATC 3 cut(s) 106, 415, 435
DraIII CACNNNGTG 1 cut(s) 368
Eam1104I CTCTTC 1 cut(s) 474
EarI CTCTTC 1 cut(s) 474
Ecl136II GAGCTC 1 cut(s) 64
Eco130I CCWWGG 2 cut(s) 17, 184
Eco24I GRGCYC 1 cut(s) 66
Eco47I GGWCC 2 cut(s) 602, 918
Eco53kI GAGCTC 1 cut(s) 64
Eco88I CYCGRG 1 cut(s) 583
EcoICRI GAGCTC 1 cut(s) 64
EcoO109I RGGNCCY 2 cut(s) 674, 918
EcoRII CCWGG 1 cut(s) 920
EcoT14I CCWWGG 2 cut(s) 17, 184
EcoT38I GRGCYC 1 cut(s) 66
ErhI CCWWGG 2 cut(s) 17, 184
FaeI CATG 5 cut(s) 313, 331, 622, 932, 994
FaqI GGGAC 1 cut(s) 753
FatI CATG 5 cut(s) 309, 327, 618, 928, 990
Fnu4HI GCNGC 1 cut(s) 562
FokI GGATG 2 cut(s) 58, 328
FriOI GRGCYC 1 cut(s) 66
Fsp4HI GCNGC 1 cut(s) 562
FspBI CTAG 4 cut(s) 18, 185, 272, 419
GluI GCNGC 1 cut(s) 562
GsuI CTGGAG 1 cut(s) 943
HaeIII GGCC 1 cut(s) 676
Hin1II CATG 5 cut(s) 313, 331, 622, 932, 994
HincII GTYRAC 1 cut(s) 230
HindII GTYRAC 1 cut(s) 230
HindIII AAGCTT 1 cut(s) 553
HinfI GANTC 4 cut(s) 569, 751, 870, 882
HphI GGTGA 2 cut(s) 800, 919
Hpy166II GTNNAC 1 cut(s) 230
Hpy188I TCNGA 4 cut(s) 113, 261, 415, 615
Hpy188III TCNNGA 8 cut(s) 129, 215, 302, 310, 465, 575, 583, 947
Hpy8I GTNNAC 1 cut(s) 230
HpyAV CCTTC 1 cut(s) 358
HpyCH4III ACNGT 1 cut(s) 814
HpyCH4V TGCA 4 cut(s) 89, 635, 794, 971
HpyF10VI GCNNNNNNNGC 1 cut(s) 561
HpyF3I CTNAG 6 cut(s) 65, 258, 431, 565, 614, 772
Hsp92II CATG 5 cut(s) 313, 331, 622, 932, 994
Kzo9I GATC 3 cut(s) 106, 415, 435
LmnI GCTCC 2 cut(s) 61, 188
Lsp1109I GCAGC 1 cut(s) 548
LweI GCATC 1 cut(s) 781
MaeI CTAG 4 cut(s) 18, 185, 272, 419
MaeIII GTNAC 2 cut(s) 336, 587
MalI GATC 3 cut(s) 108, 417, 437
MboI GATC 3 cut(s) 106, 415, 435
MboII GAAGA 6 cut(s) 190, 408, 491, 543, 830, 836
MhlI GDGCHC 2 cut(s) 8, 66
MluCI AATT 8 cut(s) 35, 221, 380, 384, 505, 606, 695, 982
MnlI CCTC 8 cut(s) 107, 246, 355, 384, 426, 590, 621, 909
MroXI GAANNNNTTC 1 cut(s) 695
MseI TTAA 6 cut(s) 38, 240, 333, 383, 707, 912
MslI CAYNNNNRTG 1 cut(s) 597
MspCI CTTAAG 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 922
MvaI CCWGG 1 cut(s) 922
MwoI GCNNNNNNNGC 1 cut(s) 561
NdeII GATC 3 cut(s) 106, 415, 435
NlaIII CATG 5 cut(s) 313, 331, 622, 932, 994
NlaIV GGNNCC 3 cut(s) 119, 190, 675
NspI RCATGY 1 cut(s) 932
PaeR7I CTCGAG 1 cut(s) 583
PagI TCATGA 1 cut(s) 309
PdmI GAANNNNTTC 1 cut(s) 695
PfeI GAWTC 4 cut(s) 569, 751, 870, 882
PfoI TCCNGGA 1 cut(s) 920
PkrI GCNGC 1 cut(s) 563
PpuMI RGGWCCY 1 cut(s) 918
PshBI ATTAAT 1 cut(s) 383
Psp124BI GAGCTC 1 cut(s) 66
Psp5II RGGWCCY 1 cut(s) 918
Psp6I CCWGG 1 cut(s) 920
PspGI CCWGG 1 cut(s) 920
PspN4I GGNNCC 3 cut(s) 119, 190, 675
PspPI GGNCC 3 cut(s) 602, 674, 918
PspPPI RGGWCCY 1 cut(s) 918
PsrI GAACNNNNNNTAC 2 cut(s) 641, 673
RseI CAYNNNNRTG 1 cut(s) 597
SacI GAGCTC 1 cut(s) 66
SaqAI TTAA 6 cut(s) 38, 240, 333, 383, 707, 912
SatI GCNGC 1 cut(s) 562
Sau3AI GATC 3 cut(s) 106, 415, 435
Sau96I GGNCC 3 cut(s) 602, 674, 918
ScrFI CCNGG 1 cut(s) 922
SduI GDGCHC 2 cut(s) 8, 66
SfaNI GCATC 1 cut(s) 781
Sfr274I CTCGAG 1 cut(s) 583
SinI GGWCC 2 cut(s) 602, 918
SlaI CTCGAG 1 cut(s) 583
SmiMI CAYNNNNRTG 1 cut(s) 597
SmlI CTYRAG 3 cut(s) 239, 556, 583
SmoI CTYRAG 3 cut(s) 239, 556, 583
Sse9I AATT 8 cut(s) 35, 221, 380, 384, 505, 606, 695, 982
SspI AATATT 1 cut(s) 410
SspMI CTAG 4 cut(s) 18, 185, 272, 419
SstI GAGCTC 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 920
StyI CCWWGG 2 cut(s) 17, 184
TaaI ACNGT 1 cut(s) 814
TaqI TCGA 1 cut(s) 584
TasI AATT 8 cut(s) 35, 221, 380, 384, 505, 606, 695, 982
TfiI GAWTC 4 cut(s) 569, 751, 870, 882
Tru1I TTAA 6 cut(s) 38, 240, 333, 383, 707, 912
Tru9I TTAA 6 cut(s) 38, 240, 333, 383, 707, 912
TscAI CASTG 1 cut(s) 208
TseI GCWGC 1 cut(s) 561
TspDTI ATGAA 6 cut(s) 326, 420, 837, 849, 862, 971
TspRI CASTG 1 cut(s) 208
Vha464I CTTAAG 1 cut(s) 239
VpaK11BI GGWCC 2 cut(s) 602, 918
VspI ATTAAT 1 cut(s) 383
XapI RAATTY 1 cut(s) 505
XceI RCATGY 1 cut(s) 932
XhoI CTCGAG 1 cut(s) 583
XmaJI CCTAGG 2 cut(s) 17, 184
XmnI GAANNNNTTC 1 cut(s) 695
XspI CTAG 4 cut(s) 18, 185, 272, 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.