Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012353.1

Orthogroup ID

OG0000285

Physical Location & Seq

Genomic Coordinates Reverse (-)

16 .. 1123

Gene Structure 1108 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012353.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 708 bp

atgaaccccgcatttccagcacggctgagaactcaagcattccttactactataactctcttaaatgttggaatttacgacacaatacctgattggtttccgagaatttcaccactccttgaacaggtagatctttctaagaaccagttaaggggaaggcttcctaaatcggtaaatcctcttctacaaagggtttatttggatatgaacagtttagagggttccctcccattttggccaaatgtaacggatctcaccttggcaagcaatagattttcaggaccaatacccttgaacattggcaatcagatgccaatgttatctaatctagatctttcaaggaataatatacacggtactattccctctttttcgaatagcaccaagttgaacactcttgacctctcaaggaattatttatcaggaagtattcctatggattggtcaggtttacaaggcctcgaggtagatctttctaagaaccagttaaggggaaggcttcctaaatcgggagcttccagtgttcttgcaatattgtcaaccgctgggtgcactggatctttcgatcaggaaacaaatgcttcggggcattaccagagtggattggagaatgcctacaatcattgtcatatctacttcgatgagccaacatgcttgctggaaatataccttagcaattatgcggtctctccaatcttcaggttttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003002 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0007275 GO:0007389 GO:0008150 GO:0008152 GO:0009719 GO:0009725 GO:0009733 GO:0009734 GO:0009741 GO:0009742 GO:0009755 GO:0009987 GO:0010033 GO:0010051 GO:0010232 GO:0010233 GO:0010305 GO:0014070 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0023052 GO:0032501 GO:0032502 GO:0032870 GO:0033993 GO:0036211 GO:0038023 GO:0042221 GO:0043170 GO:0043401 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0048545 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051716 GO:0060089 GO:0065007 GO:0070887 GO:0071310 GO:0071365 GO:0071367 GO:0071383 GO:0071396 GO:0071407 GO:0071495 GO:0071704 GO:0140096 GO:1901564 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

235

Amino Acids

26.11

Weight (kDa)

6.41

Isoelectric Point (pI)

41.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000285)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47885
fragaria_vesca	FvH4_3g09550 FvH4_4g32560
malus_domestica	MD01G1172200.v1.1
rosa_chinensis	RchiOBHm_Chr1g0353911 RchiOBHm_Chr1g0354141 RchiOBHm_Chr1g0354151 RchiOBHm_Chr1g0354161 RchiOBHm_Chr1g0354191 RchiOBHm_Chr1g0354201 RchiOBHm_Chr1g0354221 RchiOBHm_Chr1g0354271 RchiOBHm_Chr1g0354301 RchiOBHm_Chr1g0354321 RchiOBHm_Chr1g0354371 RchiOBHm_Chr1g0354401 RchiOBHm_Chr1g0354411 RchiOBHm_Chr1g0354451 RchiOBHm_Chr1g0354551 RchiOBHm_Chr1g0359231 RchiOBHm_Chr3g0470501 RchiOBHm_Chr4g0440611 RchiOBHm_Chr4g0440631 RchiOBHm_Chr4g0441421 RchiOBHm_Chr4g0441431 RchiOBHm_Chr5g0015191 RchiOBHm_Chr5g0022441 RchiOBHm_Chr7g0207081
rosa_laevigata	RLG00000009355 RLG00000009356 RLG00000023813 RLG00000024262 RLG00000028199 RLG00000028200 RLG00000028204 RLG00000028209 RLG00000028211 RLG00000028214 RLG00000028216 RLG00000028220 RLG00000028221 RLG00000028223 RLG00000028224 RLG00000028886 RLG00000029706 RLG00000032176
rosa_multiflora	Rmu_co8366321.1_g000001 Rmu_sc0001926.1_g000008 Rmu_sc0001926.1_g000009 Rmu_sc0002115.1_g000006 Rmu_sc0002115.1_g000007 Rmu_sc0002209.1_g000020 Rmu_sc0002737.1_g000005 Rmu_sc0002737.1_g000009 Rmu_sc0002737.1_g000015 Rmu_sc0002737.1_g000016 Rmu_sc0002737.1_g000018 Rmu_sc0002930.1_g000003 Rmu_sc0002930.1_g000005 Rmu_sc0003292.1_g000004 Rmu_sc0003360.1_g000004 Rmu_sc0003360.1_g000005 Rmu_sc0003381.1_g000013 Rmu_sc0004299.1_g000001 Rmu_sc0007159.1_g000001 Rmu_sc0007159.1_g000007 Rmu_sc0009777.1_g000002 Rmu_sc0010755.1_g000002 Rmu_sc0012353.1_g000001 Rmu_sc0012562.1_g000003 Rmu_sc0012562.1_g000004 Rmu_sc0012562.1_g000006 Rmu_sc0012562.1_g000013 Rmu_sc0012562.1_g000021 Rmu_sc0015525.1_g000001 Rmu_sc0015525.1_g000005 Rmu_sc0018378.1_g000001 Rmu_sc0022127.1_g000002 Rmu_sc0022144.1_g000002 Rmu_sc0035791.1_g000001
rosa_roxburghii	Rroxscaffold_1G00056680 Rroxscaffold_1G00061360 Rroxscaffold_3G00236900 Rroxscaffold_4G00300940 Rroxscaffold_4G00301040 Rroxscaffold_4G00301050 Rroxscaffold_4G00301070 Rroxscaffold_4G00301100 Rroxscaffold_4G00301110 Rroxscaffold_4G00301930 Rroxscaffold_4G00301940 Rroxscaffold_4G00301950 Rroxscaffold_7G00202690
rosa_rugosa	Rorug01G0242000 Rorug01G0242100 Rorug01G0242200 Rorug01G0242300 Rorug01G0242700 Rorug01G0242900 Rorug01G0243000 Rorug03G0109600 Rorug03G0109700 Rorug04G0327000 Rorug04G0333500 Rorug04G0333600 Rorug05G0024600 RorugPtG0003000
rosa_samantha	Rh1AG253200 Rh1AG253400 Rh1BG225200 Rh1CG177100 Rh1CG234500 Rh1CG237000 Rh1DG252000 Rh1DG252400 Rh1DG252900 Rh3CG085900 Rh4BG399300 Rh4DG391900
rosa_wichuraiana	Rw1G015760 Rw1G022030 Rw1G022100 Rw1G022120 Rw1G022230 Rw5G010290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AbsI	CCTCGAGG	1 cut(s)	461
AciI	CCGC	3 cut(s)	9, 543, 683
AclWI	GGATC	2 cut(s)	258, 565
AcoI	YGGCCR	1 cut(s)	236
AcsI	RAATTY	2 cut(s)	72, 105
AcuI	CTGAAG	1 cut(s)	682
AfaI	GTAC	1 cut(s)	358
AfiI	CCNNNNNNNGG	4 cut(s)	124, 151, 490, 509
AgsI	TTSAA	4 cut(s)	122, 295, 339, 391
AluBI	AGCT	1 cut(s)	515
AluI	AGCT	1 cut(s)	515
Alw21I	GWGCWC	1 cut(s)	554
Alw26I	GTCTC	1 cut(s)	691
Alw44I	GTGCAC	1 cut(s)	550
AlwI	GGATC	2 cut(s)	258, 565
Ama87I	CYCGRG	1 cut(s)	461
AoxI	GGCC	2 cut(s)	236, 457
ApaLI	GTGCAC	1 cut(s)	550
ApoI	RAATTY	2 cut(s)	72, 105
AspS9I	GGNCC	1 cut(s)	281
AsuHPI	GGTGA	2 cut(s)	102, 247
AsuII	TTCGAA	1 cut(s)	374
AvaI	CYCGRG	1 cut(s)	461
AvaII	GGWCC	1 cut(s)	281
BaeGI	GKGCMC	1 cut(s)	554
BalI	TGGCCA	1 cut(s)	238
BarI	GAAGNNNNNNTAC	2 cut(s)	165, 197
Bbv12I	GWGCWC	1 cut(s)	554
BceAI	ACGGC	1 cut(s)	38
BcoDI	GTCTC	1 cut(s)	691
BfaI	CTAG	1 cut(s)	329
BglII	AGATCT	3 cut(s)	130, 331, 469
Bme18I	GGWCC	1 cut(s)	281
BmeT110I	CYCGRG	1 cut(s)	461
BmgT120I	GGNCC	1 cut(s)	281
BmiI	GGNNCC	1 cut(s)	223
BmsI	GCATC	1 cut(s)	300
Bpu10I	CCTNAGC	1 cut(s)	671
Bpu14I	TTCGAA	1 cut(s)	374
BpuEI	CTTGAG	2 cut(s)	18, 391
BsaI	GGTCTC	1 cut(s)	691
BsaJI	CCNNGG	1 cut(s)	258
Bsc4I	CCNNNNNNNGG	4 cut(s)	124, 151, 490, 509
Bse1I	ACTGG	4 cut(s)	145, 484, 519, 559
BseDI	CCNNGG	1 cut(s)	258
BseLI	CCNNNNNNNGG	4 cut(s)	124, 151, 490, 509
BseMII	CTCAG	1 cut(s)	17
BseNI	ACTGG	4 cut(s)	145, 484, 519, 559
BseSI	GKGCMC	1 cut(s)	554
BseYI	CCCAGC	1 cut(s)	545
BshFI	GGCC	2 cut(s)	238, 459
BsiHKAI	GWGCWC	1 cut(s)	554
BsiHKCI	CYCGRG	1 cut(s)	461
BslI	CCNNNNNNNGG	4 cut(s)	124, 151, 490, 509
BsmAI	GTCTC	1 cut(s)	691
BsmI	GAATGC	2 cut(s)	38, 616
BsnI	GGCC	2 cut(s)	238, 459
Bso31I	GGTCTC	1 cut(s)	691
BsoBI	CYCGRG	1 cut(s)	461
Bsp119I	TTCGAA	1 cut(s)	374
Bsp1286I	GDGCHC	1 cut(s)	554
Bsp143I	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
BspACI	CCGC	3 cut(s)	9, 543, 683
BspANI	GGCC	2 cut(s)	238, 459
BspCNI	CTCAG	1 cut(s)	18
BspLI	GGNNCC	1 cut(s)	223
BspPI	GGATC	2 cut(s)	258, 565
BspT104I	TTCGAA	1 cut(s)	374
BspTNI	GGTCTC	1 cut(s)	691
BsrI	ACTGG	4 cut(s)	145, 484, 519, 559
BssECI	CCNNGG	1 cut(s)	258
BssMI	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
BssT1I	CCWWGG	1 cut(s)	258
Bst4CI	ACNGT	2 cut(s)	212, 356
Bst6I	CTCTTC	1 cut(s)	186
BstBI	TTCGAA	1 cut(s)	374
BstC8I	GCNNGC	2 cut(s)	265, 656
BstDEI	CTNAG	4 cut(s)	26, 138, 477, 671
BstENI	CCTNNNNNAGG	1 cut(s)	122
BstKTI	GATC	6 cut(s)	133, 253, 334, 472, 560, 568
BstMAI	GTCTC	1 cut(s)	691
BstMBI	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
BstMWI	GCNNNNNNNGC	1 cut(s)	17
BstNSI	RCATGY	1 cut(s)	654
BstSLI	GKGCMC	1 cut(s)	554
BstX2I	RGATCY	5 cut(s)	130, 250, 331, 469, 557
BstYI	RGATCY	5 cut(s)	130, 250, 331, 469, 557
BsuRI	GGCC	2 cut(s)	238, 459
BtsIMutI	CAGTG	2 cut(s)	526, 552
Cac8I	GCNNGC	2 cut(s)	265, 656
Cfr13I	GGNCC	1 cut(s)	281
Csp6I	GTAC	1 cut(s)	357
CviAII	CATG	1 cut(s)	651
CviJI	RGCY	7 cut(s)	25, 160, 238, 459, 499, 515, 646
CviKI_1	RGCY	7 cut(s)	25, 160, 238, 459, 499, 515, 646
CviQI	GTAC	1 cut(s)	357
DdeI	CTNAG	4 cut(s)	26, 138, 477, 671
DpnI	GATC	6 cut(s)	132, 252, 333, 471, 559, 567
DpnII	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
EaeI	YGGCCR	1 cut(s)	236
Eam1104I	CTCTTC	1 cut(s)	186
EarI	CTCTTC	1 cut(s)	186
Eco130I	CCWWGG	1 cut(s)	258
Eco147I	AGGCCT	1 cut(s)	459
Eco31I	GGTCTC	1 cut(s)	691
Eco47I	GGWCC	1 cut(s)	281
Eco57I	CTGAAG	1 cut(s)	682
Eco88I	CYCGRG	1 cut(s)	461
EcoNI	CCTNNNNNAGG	1 cut(s)	122
EcoT14I	CCWWGG	1 cut(s)	258
ErhI	CCWWGG	1 cut(s)	258
FaeI	CATG	1 cut(s)	654
FaiI	YATR	8 cut(s)	53, 206, 350, 437, 630, 652, 667, 681
FalI	AAGNNNNNCTT	2 cut(s)	27, 59
FatI	CATG	1 cut(s)	650
FauI	CCCGC	1 cut(s)	16
FspBI	CTAG	1 cut(s)	329
GsaI	CCCAGC	1 cut(s)	549
HaeIII	GGCC	2 cut(s)	238, 459
Hin1II	CATG	1 cut(s)	654
HincII	GTYRAC	1 cut(s)	540
HindII	GTYRAC	1 cut(s)	540
HphI	GGTGA	2 cut(s)	102, 247
Hpy166II	GTNNAC	3 cut(s)	452, 540, 552
Hpy188I	TCNGA	2 cut(s)	102, 309
Hpy188III	TCNNGA	6 cut(s)	279, 329, 398, 423, 510, 569
Hpy8I	GTNNAC	3 cut(s)	452, 540, 552
HpyAV	CCTTC	2 cut(s)	150, 489
HpyCH4III	ACNGT	2 cut(s)	212, 356
HpyCH4V	TGCA	2 cut(s)	530, 552
HpyF10VI	GCNNNNNNNGC	1 cut(s)	17
HpyF3I	CTNAG	4 cut(s)	26, 138, 477, 671
Hsp92II	CATG	1 cut(s)	654
Kzo9I	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
LmnI	GCTCC	1 cut(s)	512
LweI	GCATC	1 cut(s)	300
MaeI	CTAG	1 cut(s)	329
MaeIII	GTNAC	1 cut(s)	244
MalI	GATC	6 cut(s)	132, 252, 333, 471, 559, 567
MboI	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
MboII	GAAGA	2 cut(s)	173, 688
MflI	RGATCY	5 cut(s)	130, 250, 331, 469, 557
MhlI	GDGCHC	1 cut(s)	554
MlsI	TGGCCA	1 cut(s)	238
MluCI	AATT	4 cut(s)	72, 105, 412, 676
MluNI	TGGCCA	1 cut(s)	238
MmeI	TCCRAC	1 cut(s)	49
MnlI	CCTC	7 cut(s)	189, 211, 236, 376, 413, 457, 470
Mox20I	TGGCCA	1 cut(s)	238
MscI	TGGCCA	1 cut(s)	238
MseI	TTAA	3 cut(s)	62, 149, 488
Msp20I	TGGCCA	1 cut(s)	238
MspA1I	CMGCKG	1 cut(s)	545
Mva1269I	GAATGC	2 cut(s)	38, 616
MwoI	GCNNNNNNNGC	1 cut(s)	17
NdeII	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
NlaIII	CATG	1 cut(s)	654
NlaIV	GGNNCC	1 cut(s)	223
NspI	RCATGY	1 cut(s)	654
NspV	TTCGAA	1 cut(s)	374
PaeR7I	CTCGAG	1 cut(s)	461
PceI	AGGCCT	1 cut(s)	459
PctI	GAATGC	2 cut(s)	38, 616
PspFI	CCCAGC	1 cut(s)	545
PspN4I	GGNNCC	1 cut(s)	223
PspPI	GGNCC	1 cut(s)	281
PspXI	VCTCGAGB	1 cut(s)	461
PsuI	RGATCY	5 cut(s)	130, 250, 331, 469, 557
RsaI	GTAC	1 cut(s)	358
RsaNI	GTAC	1 cut(s)	357
SaqAI	TTAA	3 cut(s)	62, 149, 488
Sau3AI	GATC	6 cut(s)	130, 250, 331, 469, 557, 565
Sau96I	GGNCC	1 cut(s)	281
SduI	GDGCHC	1 cut(s)	554
SetI	ASST	9 cut(s)	91, 129, 260, 405, 451, 468, 517, 672, 704
SfaNI	GCATC	1 cut(s)	300
Sfr274I	CTCGAG	1 cut(s)	461
SfuI	TTCGAA	1 cut(s)	374
SinI	GGWCC	1 cut(s)	281
SlaI	CTCGAG	1 cut(s)	461
SmlI	CTYRAG	3 cut(s)	33, 406, 461
SmoI	CTYRAG	3 cut(s)	33, 406, 461
Sse9I	AATT	4 cut(s)	72, 105, 412, 676
SseBI	AGGCCT	1 cut(s)	459
SsiI	CCGC	3 cut(s)	9, 543, 683
SspI	AATATT	1 cut(s)	534
SspMI	CTAG	1 cut(s)	329
StuI	AGGCCT	1 cut(s)	459
StyI	CCWWGG	1 cut(s)	258
TaaI	ACNGT	2 cut(s)	212, 356
TaqI	TCGA	4 cut(s)	374, 462, 564, 639
TasI	AATT	4 cut(s)	72, 105, 412, 676
Tru1I	TTAA	3 cut(s)	62, 149, 488
Tru9I	TTAA	3 cut(s)	62, 149, 488
TscAI	CASTG	2 cut(s)	526, 559
TspDTI	ATGAA	2 cut(s)	17, 221
TspGWI	ACGGA	1 cut(s)	263
TspRI	CASTG	2 cut(s)	526, 559
VneI	GTGCAC	1 cut(s)	550
VpaK11BI	GGWCC	1 cut(s)	281
XagI	CCTNNNNNAGG	1 cut(s)	122
XapI	RAATTY	2 cut(s)	72, 105
XbaI	TCTAGA	1 cut(s)	328
XceI	RCATGY	1 cut(s)	654
XhoI	CTCGAG	1 cut(s)	461
XspI	CTAG	1 cut(s)	329

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.