Rmu_sc0009650.1_g000010

Protein FAR1-RELATED SEQUENCE 5-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009650.1
Physical Location & Seq
Forward (+)
42025 .. 42402
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009650.1_g000010.1.cds

Sequence Viewer

Length: 378 bp
atggtgtgcagtgaagtggaagcctatgaattctataatagttatgctacaagaattgggtttagtgttcgaaagggaaaaaagagaagagatgcaaagaatgttgttcgacaaattaacttcatgtgttcaaaagaaggttttgaacaggatagtgatccttcagaaaccaaaaaggctgataggctagatacaagaacaggttgcaaagccatgatccgatttacattagcagaggacatgtggagagtttctcactttcatgctgagcacaatcatgaccttgctaagccagaagagagaccatttttaagatcaaatagaaaaatgtctgaagctcataaaggggtgataaagaccatgcgtgatctcgtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

14.66

Weight (kDa)

9.37

Isoelectric Point (pI)

46.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000165)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G38180
fragaria_vesca FvH4_1g09751 FvH4_1g09751 FvH4_1g09751 FvH4_1g12531 FvH4_1g19193 FvH4_2g07051 FvH4_2g17131 FvH4_2g17131 FvH4_2g28082 FvH4_5g08845 FvH4_5g26361 FvH4_5g26361 FvH4_5g26361 FvH4_5g26361 FvH4_5g39269 FvH4_6g36651 FvH4_6g38410 FvH4_7g04941 FvH4_7g04941
malus_domestica MD00G1156400.v1.1 MD02G1139600.v1.1 MD05G1144600.v1.1 MD06G1002400.v1.1 MD10G1143900.v1.1 MD15G1227300.v1.1 MD15G1252700.v1.1
prunus_persica Prupe.2G147900_v2.0.a1 Prupe.3G257900_v2.0.a1 Prupe.5G003600_v2.0.a1 Prupe.5G053800_v2.0.a1 Prupe.6G011300_v2.0.a1 Prupe.7G161400_v2.0.a1 Prupe.7G161500_v2.0.a1 Prupe.7G188000_v2.0.a1 Prupe.8G182700_v2.0.a1 Prupe.8G182700_v2.0.a1 Prupe.8G182700_v2.0.a1
pyrus_communis pycom02g11030 pycom05g13970 pycom06g00250 pycom10g12390 pycom10g12400 pycom15g20220 pycom15g22260 pycom17g05620
rosa_chinensis RchiOBHm_Chr2g0096701 RchiOBHm_Chr2g0100471 RchiOBHm_Chr2g0100481 RchiOBHm_Chr6g0281561 RchiOBHm_Chr7g0187081 RchiOBHm_Chr7g0217201 RchiOBHm_Chr7g0228321
rosa_laevigata RLG00000001574 RLG00000002527 RLG00000008169 RLG00000011104 RLG00000012963 RLG00000013720 RLG00000014615 RLG00000016663 RLG00000018214 RLG00000018621 RLG00000018622 RLG00000022494
rosa_multiflora Rmu_co8187762.1_g000001 Rmu_co8276569.1_g000001 Rmu_sc0000528.1_g000025 Rmu_sc0001095.1_g000001 Rmu_sc0001095.1_g000002 Rmu_sc0001167.1_g000007 Rmu_sc0001758.1_g000042 Rmu_sc0002147.1_g000004 Rmu_sc0002489.1_g000048 Rmu_sc0002564.1_g000015 Rmu_sc0002902.1_g000037 Rmu_sc0003565.1_g000022 Rmu_sc0003576.1_g000008 Rmu_sc0003720.1_g000022 Rmu_sc0003720.1_g000023 Rmu_sc0003862.1_g000023 Rmu_sc0006475.1_g000009 Rmu_sc0006475.1_g000010 Rmu_sc0006735.1_g000001 Rmu_sc0007586.1_g000004 Rmu_sc0009650.1_g000010 Rmu_sc0010963.1_g000005 Rmu_sc0012557.1_g000002 Rmu_sc0020744.1_g000001 Rmu_sc0020745.1_g000002 Rmu_sc0022201.1_g000001 Rmu_sc0022408.1_g000011 Rmu_sc0023414.1_g000001 Rmu_sc0025101.1_g000001 Rmu_ssc0000211.1_g000015 Rmu_ssc0000240.1_g000012
rosa_roxburghii Rroxscaffold_1G00013940 Rroxscaffold_1G00018420 Rroxscaffold_2G00142210 Rroxscaffold_2G00142230 Rroxscaffold_2G00145400 Rroxscaffold_3G00240120 Rroxscaffold_3G00240150 Rroxscaffold_3G00242500 Rroxscaffold_5G00346610 Rroxscaffold_5G00356000 Rroxscaffold_7G00187000 Rroxscaffold_7G00212120
rosa_rugosa Rorug01G0260900 Rorug01G0446900 Rorug02G0059800 Rorug02G0059900 Rorug02G0088400 Rorug02G0088500 Rorug02G0522300 Rorug03G0234100 Rorug03G0234100 Rorug03G0242400 Rorug04G0109900 Rorug04G0326100 Rorug05G0275900 Rorug06G0141600 Rorug06G0141700 Rorug06G0141700 Rorug07G0167200 Rorug07G0247000 Rorug07G0247000 Rorug07G0247100.1
rosa_samantha Rh1AG046800 Rh1AG111600 Rh1AG242600 Rh1CG226400 Rh1DG086400 Rh2AG107200 Rh2AG138100 Rh2AG528600 Rh2BG109600 Rh2BG141200 Rh2BG273400 Rh2BG357800 Rh2BG640200 Rh2CG111400 Rh2CG143400 Rh2CG161100 Rh2CG251300 Rh2DG111000 Rh2DG142900 Rh2DG651100 Rh3BG318000 Rh4AG167800 Rh4AG253700 Rh5AG282900 Rh6AG254100 Rh6BG257100 Rh6CG256400 Rh6DG248200 Rh7AG306100 Rh7BG297500 Rh7CG325200 Rh7CG420200 Rh7DG306000
rosa_wichuraiana Rw2G008310 Rw2G010790 Rw2G010800 Rw2G013840 Rw2G022430 Rw3G020550 Rw3G024980 Rw3G025930 Rw5G026810 Rw5G035870 Rw6G022060 Rw6G030700 Rw7G007420 Rw7G026010 Rw7G033340 Rw7G037700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 152, 211
AcsI RAATTY 1 cut(s) 29
AcuI CTGAAG 2 cut(s) 147, 354
AflIII ACRYGT 1 cut(s) 240
AgsI TTSAA 2 cut(s) 132, 146
AluBI AGCT 1 cut(s) 338
AluI AGCT 1 cut(s) 338
Alw21I GWGCWC 1 cut(s) 273
Alw26I GTCTC 1 cut(s) 295
AlwI GGATC 2 cut(s) 152, 211
ApoI RAATTY 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 361
AsuII TTCGAA 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 273
BcoDI GTCTC 1 cut(s) 295
BfaI CTAG 1 cut(s) 188
BlpI GCTNAGC 2 cut(s) 267, 288
BmsI GCATC 1 cut(s) 82
BplI GAGNNNNNCTC 2 cut(s) 238, 270
Bpu1102I GCTNAGC 2 cut(s) 267, 288
Bpu14I TTCGAA 1 cut(s) 70
BsaBI GATNNNNATC 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 295
Bse8I GATNNNNATC 1 cut(s) 156
BseJI GATNNNNATC 1 cut(s) 156
BseMII CTCAG 1 cut(s) 258
BsgI GTGCAG 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 273
BsmAI GTCTC 1 cut(s) 295
Bso31I GGTCTC 1 cut(s) 295
Bsp119I TTCGAA 1 cut(s) 70
Bsp1286I GDGCHC 1 cut(s) 273
Bsp143I GATC 4 cut(s) 157, 216, 314, 367
Bsp1720I GCTNAGC 2 cut(s) 267, 288
BspCNI CTCAG 1 cut(s) 259
BspHI TCATGA 1 cut(s) 277
BspPI GGATC 2 cut(s) 152, 211
BspT104I TTCGAA 1 cut(s) 70
BspTNI GGTCTC 1 cut(s) 295
BssMI GATC 4 cut(s) 157, 216, 314, 367
Bst6I CTCTTC 2 cut(s) 82, 291
BstBI TTCGAA 1 cut(s) 70
BstDEI CTNAG 2 cut(s) 267, 288
BstKTI GATC 4 cut(s) 160, 219, 317, 370
BstMAI GTCTC 1 cut(s) 295
BstMBI GATC 4 cut(s) 157, 216, 314, 367
BstNSI RCATGY 1 cut(s) 244
BtsI GCAGTG 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 16
CciI TCATGA 1 cut(s) 277
CviAII CATG 6 cut(s) 124, 214, 241, 263, 278, 361
CviJI RGCY 6 cut(s) 23, 179, 187, 212, 292, 338
CviKI_1 RGCY 6 cut(s) 23, 179, 187, 212, 292, 338
DdeI CTNAG 2 cut(s) 267, 288
DpnI GATC 4 cut(s) 159, 218, 316, 369
DpnII GATC 4 cut(s) 157, 216, 314, 367
Eam1104I CTCTTC 2 cut(s) 82, 291
EarI CTCTTC 2 cut(s) 82, 291
Eco31I GGTCTC 1 cut(s) 295
Eco57I CTGAAG 2 cut(s) 147, 354
EcoRI GAATTC 1 cut(s) 29
FaeI CATG 6 cut(s) 127, 217, 244, 266, 281, 364
FatI CATG 6 cut(s) 123, 213, 240, 262, 277, 360
FspBI CTAG 1 cut(s) 188
Hin1II CATG 6 cut(s) 127, 217, 244, 266, 281, 364
HphI GGTGA 1 cut(s) 361
Hpy188I TCNGA 3 cut(s) 166, 221, 334
Hpy188III TCNNGA 1 cut(s) 278
HpyAV CCTTC 2 cut(s) 131, 171
HpyCH4V TGCA 3 cut(s) 9, 95, 207
HpyF3I CTNAG 2 cut(s) 267, 288
Hsp92II CATG 6 cut(s) 127, 217, 244, 266, 281, 364
Kzo9I GATC 4 cut(s) 157, 216, 314, 367
LpnPI CCDG 3 cut(s) 134, 186, 306
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 188
MalI GATC 4 cut(s) 159, 218, 316, 369
MboI GATC 4 cut(s) 157, 216, 314, 367
MboII GAAGA 2 cut(s) 99, 308
MhlI GDGCHC 1 cut(s) 273
MluCI AATT 3 cut(s) 29, 54, 114
MnlI CCTC 1 cut(s) 229
MseI TTAA 2 cut(s) 117, 311
MslI CAYNNNNRTG 2 cut(s) 261, 276
NdeII GATC 4 cut(s) 157, 216, 314, 367
NlaIII CATG 6 cut(s) 127, 217, 244, 266, 281, 364
NspI RCATGY 1 cut(s) 244
NspV TTCGAA 1 cut(s) 70
PagI TCATGA 1 cut(s) 277
PciI ACATGT 1 cut(s) 240
PscI ACATGT 1 cut(s) 240
RseI CAYNNNNRTG 2 cut(s) 261, 276
SaqAI TTAA 2 cut(s) 117, 311
Sau3AI GATC 4 cut(s) 157, 216, 314, 367
SduI GDGCHC 1 cut(s) 273
SetI ASST 4 cut(s) 142, 205, 285, 340
SfaNI GCATC 1 cut(s) 82
SfuI TTCGAA 1 cut(s) 70
SmiMI CAYNNNNRTG 2 cut(s) 261, 276
Sse9I AATT 3 cut(s) 29, 54, 114
SspMI CTAG 1 cut(s) 188
TaqI TCGA 2 cut(s) 70, 109
TasI AATT 3 cut(s) 29, 54, 114
Tru1I TTAA 2 cut(s) 117, 311
Tru9I TTAA 2 cut(s) 117, 311
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 3 cut(s) 42, 112, 251
TspRI CASTG 1 cut(s) 16
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 244
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.