Rmu_ssc0000066.1_g000009

Protein FAR1-RELATED SEQUENCE 5-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000066.1
OG0000325
Physical Location & Seq
Forward (+)
22707 .. 23911
1205 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000066.1_g000009.1.cds

Sequence Viewer

Length: 1062 bp
atggaaaagggagatgctggagctatattgcaatacttccaaaaaatgaaagaggataattcatcttctttttattcaatgcagcttgatgaggatgatatgatcacaaatattttttgggcagatgagcgttcaataagtgattatggtctttttggggatgtcgtttgttttgacacaacttatcaaactaatgaatatggtagaccatttgctccatttgttggggtcaatcatcataagcaaacagtggtgtttggtgcaactctattatatgacgaaaccattgagtcctttaagtggatttttgagacttttcttggagcgatgtctggaaagcaaccaaagaccatacttacagaccaatctgcagcaattgctagtgcaatagcagaagtatttcctgcatggaataatatgctcgagaagcacaatttgaaggaggataaatggttaaagaatttgtttgatgtgagagaaaaatgggcattggtatacgggcgacatacttttactgcagatatgatgagtacacaacgtagtgagagtatgaataatattttgaaaaaatacttgaagcctagttatgacctgttgtgcttctttgaacactatgagagagttttggctgatcgaagatatgaagaattaattgctgacttcaagatgatgcaaacttctcctgtgttatctactaacttagagatgttgcaacatgcagaggaggtgtataccccagaagcttttagactcttccagcaacaatacacaagtattggtgattatgttgctaataaagttagcaagtctgagatgcaatatgaatacaaagtatcttatcgtggtgttgctcgagagcatttggtaaaatttgatgcttcaatgcaaacaataacttgtagttgcatgaagtttaattttgttgggattttatgccgtcatgcaatgaaaatgttggataggaagaatgtgagaagaatccctcctacttgcataaggagcatcactagttatcatggaccaaagactaatgaaaatctgaagcagtcgattggaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

353

Amino Acids

41.1

Weight (kDa)

6.33

Isoelectric Point (pI)

44.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000325)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24391 FvH4_2g38071 FvH4_3g07131 FvH4_3g22481 FvH4_4g15809 FvH4_5g37230 FvH4_7g25201 FvH4_7g29092 FvH4_7g29093
malus_domestica MD01G1197600.v1.1 MD17G1186900.v1.1
prunus_persica Prupe.1G227400_v2.0.a1 Prupe.2G291000_v2.0.a1 Prupe.4G268600_v2.0.a1 Prupe.5G094100_v2.0.a1
pyrus_communis pycom01g20780 pycom17g19620
rosa_chinensis RchiOBHm_Chr1g0376821 RchiOBHm_Chr5g0061941 RchiOBHm_Chr5g0078991 RchiOBHm_Chr6g0276821 RchiOBHm_Chr7g0191321
rosa_laevigata RLG00000007883 RLG00000008804 RLG00000010632 RLG00000026567 RLG00000035244 RLG00000036018 RLG00000036909
rosa_multiflora Rmu_sc0001036.1_g000026 Rmu_sc0001556.1_g000021 Rmu_sc0001974.1_g000022 Rmu_sc0002113.1_g000006 Rmu_sc0002572.1_g000008 Rmu_sc0004808.1_g000011 Rmu_sc0005117.1_g000017 Rmu_sc0005319.1_g000016 Rmu_sc0008432.1_g000005 Rmu_sc0010475.1_g000001 Rmu_sc0015522.1_g000003 Rmu_ssc0000066.1_g000009 Rmu_ssc0000400.1_g000102 Rmu_ssc0000400.1_g000103
rosa_roxburghii Rroxscaffold_1G00071290 Rroxscaffold_2G00141280 Rroxscaffold_3G00233790 Rroxscaffold_4G00297530 Rroxscaffold_5G00368860 Rroxscaffold_5G00386220 Rroxscaffold_7G00159400
rosa_rugosa Rorug01G0146800.1 Rorug01G0162100.1 Rorug01G0162200.1 Rorug01G0398600 Rorug01G0398700 Rorug02G0344200 Rorug02G0344300 Rorug02G0344400 Rorug03G0046200 Rorug03G0153200 Rorug04G0182500 Rorug04G0182600 Rorug05G0257700 Rorug05G0386400 Rorug05G0386400 Rorug05G0386500 Rorug05G0460900.1 Rorug05G0467000 Rorug07G0110400
rosa_samantha Rh1AG183500 Rh1AG416000 Rh1BG023600 Rh1BG145400 Rh1BG145500 Rh1BG278800 Rh1BG375400 Rh1CG389200 Rh1DG166300 Rh1DG176900 Rh1DG309900 Rh1DG406000 Rh2BG439100 Rh2BG502200 Rh2CG314800 Rh2CG517400 Rh2CG532000 Rh2DG449100 Rh3BG109900 Rh3CG230400 Rh3CG246600 Rh3CG289400 Rh3CG289500 Rh3DG120600 Rh4AG144400 Rh4AG408200 Rh4BG419300 Rh4CG101900 Rh4CG151000 Rh4CG226900 Rh4DG235400 Rh5AG265900 Rh5AG375200 Rh5CG559600 Rh5DG218200 Rh6AG074500 Rh6BG291800 Rh6CG292800 Rh6DG284900
rosa_wichuraiana Rw0G013240 Rw1G036490 Rw5G024920 Rw5G030730 Rw5G033710 Rw6G033840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 224
AccI GTMKAC 3 cut(s) 205, 495, 731
AcsI RAATTY 2 cut(s) 460, 869
AcuI CTGAAG 1 cut(s) 1061
AfaI GTAC 1 cut(s) 532
AfiI CCNNNNNNNGG 2 cut(s) 224, 300
AgsI TTSAA 8 cut(s) 78, 135, 439, 565, 577, 608, 664, 882
AhlI ACTAGT 1 cut(s) 1007
AluBI AGCT 3 cut(s) 23, 85, 743
AluI AGCT 3 cut(s) 23, 85, 743
Alw26I GTCTC 1 cut(s) 305
Ama87I CYCGRG 2 cut(s) 422, 852
ApeKI GCWGC 2 cut(s) 82, 371
ApoI RAATTY 2 cut(s) 460, 869
AseI ATTAAT 1 cut(s) 650
Asp700I GAANNNNTTC 1 cut(s) 399
AspS9I GGNCC 1 cut(s) 1019
AsuHPI GGTGA 1 cut(s) 791
AvaI CYCGRG 2 cut(s) 422, 852
AvaII GGWCC 1 cut(s) 1019
BbvI GCAGC 2 cut(s) 94, 383
BceAI ACGGC 1 cut(s) 921
BclI TGATCA 1 cut(s) 102
BcoDI GTCTC 1 cut(s) 305
BcuI ACTAGT 1 cut(s) 1007
BfaI CTAG 3 cut(s) 381, 582, 1008
BfmI CTRYAG 2 cut(s) 369, 516
BisI GCNGC 2 cut(s) 83, 372
BlsI GCNGC 2 cut(s) 84, 373
Bme18I GGWCC 1 cut(s) 1019
BmeT110I CYCGRG 2 cut(s) 422, 852
BmgT120I GGNCC 1 cut(s) 1019
BmsI GCATC 5 cut(s) 4, 660, 804, 865, 1011
BpmI CTGGAG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 2 cut(s) 224, 300
Bse3DI GCAATG 1 cut(s) 951
BseGI GGATG 2 cut(s) 100, 166
BseLI CCNNNNNNNGG 2 cut(s) 224, 300
BseMI GCAATG 1 cut(s) 951
BseMII CTCAG 1 cut(s) 801
BseRI GAGGAG 1 cut(s) 737
BseXI GCAGC 2 cut(s) 94, 383
BsiHKCI CYCGRG 2 cut(s) 422, 852
BslI CCNNNNNNNGG 2 cut(s) 224, 300
BsmAI GTCTC 1 cut(s) 305
BsoBI CYCGRG 2 cut(s) 422, 852
Bsp143I GATC 2 cut(s) 102, 631
BspCNI CTCAG 1 cut(s) 802
BspMAI CTGCAG 2 cut(s) 373, 520
BsrDI GCAATG 1 cut(s) 951
BssMI GATC 2 cut(s) 102, 631
BssNAI GTATAC 2 cut(s) 496, 732
Bst1107I GTATAC 2 cut(s) 496, 732
Bst4CI ACNGT 1 cut(s) 250
Bst6I CTCTTC 1 cut(s) 758
BstAPI GCANNNNNTGC 1 cut(s) 377
BstDEI CTNAG 2 cut(s) 700, 810
BstF5I GGATG 2 cut(s) 100, 166
BstKTI GATC 2 cut(s) 105, 634
BstMAI GTCTC 1 cut(s) 305
BstMBI GATC 2 cut(s) 102, 631
BstMWI GCNNNNNNNGC 3 cut(s) 377, 427, 999
BstNSI RCATGY 1 cut(s) 719
BstSFI CTRYAG 2 cut(s) 369, 516
BstV1I GCAGC 2 cut(s) 94, 383
BstZ17I GTATAC 2 cut(s) 496, 732
BtgZI GCGATG 1 cut(s) 341
BtsCI GGATG 2 cut(s) 100, 166
BtsIMutI CAGTG 1 cut(s) 255
Cfr13I GGNCC 1 cut(s) 1019
Csp6I GTAC 1 cut(s) 531
CviAII CATG 5 cut(s) 408, 716, 907, 941, 1016
CviJI RGCY 5 cut(s) 23, 85, 580, 629, 743
CviKI_1 RGCY 5 cut(s) 23, 85, 580, 629, 743
CviQI GTAC 1 cut(s) 531
DdeI CTNAG 2 cut(s) 700, 810
DpnI GATC 2 cut(s) 104, 633
DpnII GATC 2 cut(s) 102, 631
Eam1104I CTCTTC 1 cut(s) 758
EarI CTCTTC 1 cut(s) 758
Eco47I GGWCC 1 cut(s) 1019
Eco57I CTGAAG 1 cut(s) 1061
Eco88I CYCGRG 2 cut(s) 422, 852
FaeI CATG 5 cut(s) 411, 719, 910, 944, 1019
FatI CATG 5 cut(s) 407, 715, 906, 940, 1015
FbaI TGATCA 1 cut(s) 102
FblI GTMKAC 3 cut(s) 205, 495, 731
Fnu4HI GCNGC 2 cut(s) 83, 372
FokI GGATG 2 cut(s) 107, 173
Fsp4HI GCNGC 2 cut(s) 83, 372
FspBI CTAG 3 cut(s) 381, 582, 1008
GluI GCNGC 2 cut(s) 83, 372
GsuI CTGGAG 1 cut(s) 39
Hin1II CATG 5 cut(s) 411, 719, 910, 944, 1019
HindIII AAGCTT 1 cut(s) 741
HinfI GANTC 3 cut(s) 290, 750, 978
HphI GGTGA 1 cut(s) 791
Hpy166II GTNNAC 4 cut(s) 206, 496, 533, 732
Hpy188I TCNGA 2 cut(s) 811, 1041
Hpy188III TCNNGA 4 cut(s) 333, 424, 664, 854
Hpy8I GTNNAC 4 cut(s) 206, 496, 533, 732
HpyAV CCTTC 1 cut(s) 433
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4IV ACGT 1 cut(s) 538
HpyF10VI GCNNNNNNNGC 3 cut(s) 377, 427, 999
HpyF3I CTNAG 2 cut(s) 700, 810
HpySE526I ACGT 1 cut(s) 538
Hsp92II CATG 5 cut(s) 411, 719, 910, 944, 1019
Ksp22I TGATCA 1 cut(s) 102
Kzo9I GATC 2 cut(s) 102, 631
LmnI GCTCC 4 cut(s) 20, 220, 323, 999
LpnPI CCDG 7 cut(s) 3, 318, 417, 605, 696, 750, 770
Lsp1109I GCAGC 2 cut(s) 94, 383
LweI GCATC 5 cut(s) 4, 660, 804, 865, 1011
MaeI CTAG 3 cut(s) 381, 582, 1008
MaeII ACGT 1 cut(s) 538
MalI GATC 2 cut(s) 104, 633
MboI GATC 2 cut(s) 102, 631
MboII GAAGA 6 cut(s) 57, 648, 656, 745, 976, 987
MfeI CAATTG 1 cut(s) 375
MluCI AATT 8 cut(s) 58, 375, 433, 460, 647, 651, 869, 916
MlyI GAGTC 2 cut(s) 299, 744
MmeI TCCRAC 1 cut(s) 936
MnlI CCTC 6 cut(s) 46, 85, 436, 715, 718, 993
MroXI GAANNNNTTC 1 cut(s) 399
MseI TTAA 4 cut(s) 297, 455, 650, 915
MunI CAATTG 1 cut(s) 375
MwoI GCNNNNNNNGC 3 cut(s) 377, 427, 999
NdeII GATC 2 cut(s) 102, 631
NlaIII CATG 5 cut(s) 411, 719, 910, 944, 1019
NspI RCATGY 1 cut(s) 719
PaeR7I CTCGAG 2 cut(s) 422, 852
PdmI GAANNNNTTC 1 cut(s) 399
PfeI GAWTC 1 cut(s) 978
PflMI CCANNNNNTGG 1 cut(s) 224
PkrI GCNGC 2 cut(s) 84, 373
PleI GAGTC 2 cut(s) 298, 744
PpsI GAGTC 2 cut(s) 298, 744
PshBI ATTAAT 1 cut(s) 650
PspPI GGNCC 1 cut(s) 1019
PstI CTGCAG 2 cut(s) 373, 520
RsaI GTAC 1 cut(s) 532
RsaNI GTAC 1 cut(s) 531
SaqAI TTAA 4 cut(s) 297, 455, 650, 915
SatI GCNGC 2 cut(s) 83, 372
Sau3AI GATC 2 cut(s) 102, 631
Sau96I GGNCC 1 cut(s) 1019
SchI GAGTC 2 cut(s) 299, 744
SetI ASST 6 cut(s) 25, 87, 541, 594, 729, 745
SfaNI GCATC 5 cut(s) 4, 660, 804, 865, 1011
SfcI CTRYAG 2 cut(s) 369, 516
Sfr274I CTCGAG 2 cut(s) 422, 852
SinI GGWCC 1 cut(s) 1019
SlaI CTCGAG 2 cut(s) 422, 852
SmlI CTYRAG 2 cut(s) 422, 852
SmoI CTYRAG 2 cut(s) 422, 852
SpeI ACTAGT 1 cut(s) 1007
Sse9I AATT 8 cut(s) 58, 375, 433, 460, 647, 651, 869, 916
SspI AATATT 2 cut(s) 112, 559
SspMI CTAG 3 cut(s) 381, 582, 1008
TaaI ACNGT 1 cut(s) 250
TaiI ACGT 1 cut(s) 541
TaqI TCGA 4 cut(s) 423, 634, 853, 1049
TasI AATT 8 cut(s) 58, 375, 433, 460, 647, 651, 869, 916
TatI WGTACW 1 cut(s) 530
TfiI GAWTC 1 cut(s) 978
Tru1I TTAA 4 cut(s) 297, 455, 650, 915
Tru9I TTAA 4 cut(s) 297, 455, 650, 915
TscAI CASTG 1 cut(s) 255
TseI GCWGC 2 cut(s) 82, 371
TspDTI ATGAA 9 cut(s) 51, 62, 210, 566, 657, 837, 923, 962, 1047
TspRI CASTG 1 cut(s) 255
Van91I CCANNNNNTGG 1 cut(s) 224
VpaK11BI GGWCC 1 cut(s) 1019
VspI ATTAAT 1 cut(s) 650
XapI RAATTY 2 cut(s) 460, 869
XceI RCATGY 1 cut(s) 719
XhoI CTCGAG 2 cut(s) 422, 852
XmiI GTMKAC 3 cut(s) 205, 495, 731
XmnI GAANNNNTTC 1 cut(s) 399
XspI CTAG 3 cut(s) 381, 582, 1008
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.