Rh4CG226900

Protein FAR1-RELATED SEQUENCE 5-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
46383778 .. 46385665
1888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG226900.1

Sequence Viewer

Length: 264 bp
ATGGAACACAAATCTCCTGTGCTATCAACACCGGATGTGGAAGCTACAGATAGTTGTGATTGTCAAATATCTAGCAAATTGGAATTTGGGAGTGGTATAGACTTGAATTGTTCTGTAGAAGTTGAAAATAAGATGGTCAGAGGAATCAAGGTTAAAGAAAGAATTGTTCGTAAGGAGGAATCTATTAGACCAAAGAATGCTCTGGAAAAGCTCTTAAGAAACAAAAGTGGTCTTCACGTTTTGCTTGGCCTGGTGATTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.63

Weight (kDa)

7.73

Isoelectric Point (pI)

40.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000325)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24391 FvH4_2g38071 FvH4_3g07131 FvH4_3g22481 FvH4_4g15809 FvH4_5g37230 FvH4_7g25201 FvH4_7g29092 FvH4_7g29093
malus_domestica MD01G1197600.v1.1 MD17G1186900.v1.1
prunus_persica Prupe.1G227400_v2.0.a1 Prupe.2G291000_v2.0.a1 Prupe.4G268600_v2.0.a1 Prupe.5G094100_v2.0.a1
pyrus_communis pycom01g20780 pycom17g19620
rosa_chinensis RchiOBHm_Chr1g0376821 RchiOBHm_Chr5g0061941 RchiOBHm_Chr5g0078991 RchiOBHm_Chr6g0276821 RchiOBHm_Chr7g0191321
rosa_laevigata RLG00000007883 RLG00000008804 RLG00000010632 RLG00000026567 RLG00000035244 RLG00000036018 RLG00000036909
rosa_multiflora Rmu_sc0001036.1_g000026 Rmu_sc0001556.1_g000021 Rmu_sc0001974.1_g000022 Rmu_sc0002113.1_g000006 Rmu_sc0002572.1_g000008 Rmu_sc0004808.1_g000011 Rmu_sc0005117.1_g000017 Rmu_sc0005319.1_g000016 Rmu_sc0008432.1_g000005 Rmu_sc0010475.1_g000001 Rmu_sc0015522.1_g000003 Rmu_ssc0000066.1_g000009 Rmu_ssc0000400.1_g000102 Rmu_ssc0000400.1_g000103
rosa_roxburghii Rroxscaffold_1G00071290 Rroxscaffold_2G00141280 Rroxscaffold_3G00233790 Rroxscaffold_4G00297530 Rroxscaffold_5G00368860 Rroxscaffold_5G00386220 Rroxscaffold_7G00159400
rosa_rugosa Rorug01G0146800.1 Rorug01G0162100.1 Rorug01G0162200.1 Rorug01G0398600 Rorug01G0398700 Rorug02G0344200 Rorug02G0344300 Rorug02G0344400 Rorug03G0046200 Rorug03G0153200 Rorug04G0182500 Rorug04G0182600 Rorug05G0257700 Rorug05G0386400 Rorug05G0386400 Rorug05G0386500 Rorug05G0460900.1 Rorug05G0467000 Rorug07G0110400
rosa_samantha Rh1AG183500 Rh1AG416000 Rh1BG023600 Rh1BG145400 Rh1BG145500 Rh1BG278800 Rh1BG375400 Rh1CG389200 Rh1DG166300 Rh1DG176900 Rh1DG309900 Rh1DG406000 Rh2BG439100 Rh2BG502200 Rh2CG314800 Rh2CG517400 Rh2CG532000 Rh2DG449100 Rh3BG109900 Rh3CG230400 Rh3CG246600 Rh3CG289400 Rh3CG289500 Rh3DG120600 Rh4AG144400 Rh4AG408200 Rh4BG419300 Rh4CG101900 Rh4CG151000 Rh4CG226900 Rh4DG235400 Rh5AG265900 Rh5AG375200 Rh5CG559600 Rh5DG218200 Rh6AG074500 Rh6BG291800 Rh6CG292800 Rh6DG284900
rosa_wichuraiana Rw0G013240 Rw1G036490 Rw5G024920 Rw5G030730 Rw5G033710 Rw6G033840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 83
AflII CTTAAG 1 cut(s) 214
AgsI TTSAA 2 cut(s) 106, 125
AjnI CCWGG 1 cut(s) 249
AluBI AGCT 2 cut(s) 44, 211
AluI AGCT 2 cut(s) 44, 211
AoxI GGCC 1 cut(s) 247
ApoI RAATTY 1 cut(s) 83
BbsI GAAGAC 1 cut(s) 224
BccI CCATC 1 cut(s) 127
BciT130I CCWGG 1 cut(s) 251
BfaI CTAG 1 cut(s) 72
BfmI CTRYAG 2 cut(s) 45, 114
BfrI CTTAAG 1 cut(s) 214
Bme1390I CCNGG 1 cut(s) 251
BmrFI CCNGG 1 cut(s) 251
BpiI GAAGAC 1 cut(s) 224
BsaWI WCCGGW 1 cut(s) 31
BseBI CCWGG 1 cut(s) 251
BseGI GGATG 1 cut(s) 40
BshFI GGCC 1 cut(s) 249
BsiSI CCGG 1 cut(s) 32
BsmI GAATGC 1 cut(s) 202
BsnI GGCC 1 cut(s) 249
BspANI GGCC 1 cut(s) 249
BspTI CTTAAG 1 cut(s) 214
Bst2UI CCWGG 1 cut(s) 251
BstAFI CTTAAG 1 cut(s) 214
BstDEI CTNAG 1 cut(s) 261
BstF5I GGATG 1 cut(s) 40
BstNI CCWGG 1 cut(s) 251
BstSCI CCNGG 1 cut(s) 249
BstSFI CTRYAG 2 cut(s) 45, 114
BstV2I GAAGAC 1 cut(s) 224
BsuRI GGCC 1 cut(s) 249
BtsCI GGATG 1 cut(s) 40
CviJI RGCY 3 cut(s) 44, 211, 249
CviKI_1 RGCY 3 cut(s) 44, 211, 249
DdeI CTNAG 1 cut(s) 261
EcoRII CCWGG 1 cut(s) 249
FaiI YATR 1 cut(s) 98
FokI GGATG 1 cut(s) 47
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 1 cut(s) 249
HapII CCGG 1 cut(s) 32
HinfI GANTC 2 cut(s) 144, 179
HpaII CCGG 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 203
HpyCH4IV ACGT 1 cut(s) 237
HpyF3I CTNAG 1 cut(s) 261
HpySE526I ACGT 1 cut(s) 237
LpnPI CCDG 4 cut(s) 30, 45, 188, 236
MaeI CTAG 1 cut(s) 72
MaeII ACGT 1 cut(s) 237
MboII GAAGA 1 cut(s) 224
MluCI AATT 4 cut(s) 77, 83, 106, 162
MnlI CCTC 2 cut(s) 134, 169
MseI TTAA 2 cut(s) 153, 215
MspCI CTTAAG 1 cut(s) 214
MspI CCGG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 251
Mva1269I GAATGC 1 cut(s) 202
MvaI CCWGG 1 cut(s) 251
PctI GAATGC 1 cut(s) 202
PfeI GAWTC 2 cut(s) 144, 179
Psp6I CCWGG 1 cut(s) 249
PspGI CCWGG 1 cut(s) 249
SaqAI TTAA 2 cut(s) 153, 215
ScrFI CCNGG 1 cut(s) 251
SetI ASST 4 cut(s) 46, 153, 213, 240
SfcI CTRYAG 2 cut(s) 45, 114
SgeI CNNG 8 cut(s) 29, 44, 84, 115, 160, 215, 248, 257
SmlI CTYRAG 1 cut(s) 214
SmoI CTYRAG 1 cut(s) 214
Sse9I AATT 4 cut(s) 77, 83, 106, 162
SspMI CTAG 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 249
TaiI ACGT 1 cut(s) 240
TasI AATT 4 cut(s) 77, 83, 106, 162
TfiI GAWTC 2 cut(s) 144, 179
Tru1I TTAA 2 cut(s) 153, 215
Tru9I TTAA 2 cut(s) 153, 215
Vha464I CTTAAG 1 cut(s) 214
XapI RAATTY 1 cut(s) 83
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.