Rorug02G0344400

Protein FAR1-RELATED SEQUENCE 5-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
42991928 .. 42992095
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0344400.1

Sequence Viewer

Length: 168 bp
ATGAAGTATCTTTCTCGTGAAGCCAATTATGTAGCCGACGCTATTGTTAATTTGGGCCACAGTTCGGATACTCCTATTGCCTGGTCTAAGAAGCTACCGCTCTCAATTCTCTCTACTTTTAATTTCGATAATTTTAATTTTTGTTGTATTCGGAGTTTCAAATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.29

Weight (kDa)

8.74

Isoelectric Point (pI)

16.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000325)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24391 FvH4_2g38071 FvH4_3g07131 FvH4_3g22481 FvH4_4g15809 FvH4_5g37230 FvH4_7g25201 FvH4_7g29092 FvH4_7g29093
malus_domestica MD01G1197600.v1.1 MD17G1186900.v1.1
prunus_persica Prupe.1G227400_v2.0.a1 Prupe.2G291000_v2.0.a1 Prupe.4G268600_v2.0.a1 Prupe.5G094100_v2.0.a1
pyrus_communis pycom01g20780 pycom17g19620
rosa_chinensis RchiOBHm_Chr1g0376821 RchiOBHm_Chr5g0061941 RchiOBHm_Chr5g0078991 RchiOBHm_Chr6g0276821 RchiOBHm_Chr7g0191321
rosa_laevigata RLG00000007883 RLG00000008804 RLG00000010632 RLG00000026567 RLG00000035244 RLG00000036018 RLG00000036909
rosa_multiflora Rmu_sc0001036.1_g000026 Rmu_sc0001556.1_g000021 Rmu_sc0001974.1_g000022 Rmu_sc0002113.1_g000006 Rmu_sc0002572.1_g000008 Rmu_sc0004808.1_g000011 Rmu_sc0005117.1_g000017 Rmu_sc0005319.1_g000016 Rmu_sc0008432.1_g000005 Rmu_sc0010475.1_g000001 Rmu_sc0015522.1_g000003 Rmu_ssc0000066.1_g000009 Rmu_ssc0000400.1_g000102 Rmu_ssc0000400.1_g000103
rosa_roxburghii Rroxscaffold_1G00071290 Rroxscaffold_2G00141280 Rroxscaffold_3G00233790 Rroxscaffold_4G00297530 Rroxscaffold_5G00368860 Rroxscaffold_5G00386220 Rroxscaffold_7G00159400
rosa_rugosa Rorug01G0146800.1 Rorug01G0162100.1 Rorug01G0162200.1 Rorug01G0398600 Rorug01G0398700 Rorug02G0344200 Rorug02G0344300 Rorug02G0344400 Rorug03G0046200 Rorug03G0153200 Rorug04G0182500 Rorug04G0182600 Rorug05G0257700 Rorug05G0386400 Rorug05G0386400 Rorug05G0386500 Rorug05G0460900.1 Rorug05G0467000 Rorug07G0110400
rosa_samantha Rh1AG183500 Rh1AG416000 Rh1BG023600 Rh1BG145400 Rh1BG145500 Rh1BG278800 Rh1BG375400 Rh1CG389200 Rh1DG166300 Rh1DG176900 Rh1DG309900 Rh1DG406000 Rh2BG439100 Rh2BG502200 Rh2CG314800 Rh2CG517400 Rh2CG532000 Rh2DG449100 Rh3BG109900 Rh3CG230400 Rh3CG246600 Rh3CG289400 Rh3CG289500 Rh3DG120600 Rh4AG144400 Rh4AG408200 Rh4BG419300 Rh4CG101900 Rh4CG151000 Rh4CG226900 Rh4DG235400 Rh5AG265900 Rh5AG375200 Rh5CG559600 Rh5DG218200 Rh6AG074500 Rh6BG291800 Rh6CG292800 Rh6DG284900
rosa_wichuraiana Rw0G013240 Rw1G036490 Rw5G024920 Rw5G030730 Rw5G033710 Rw6G033840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 100
AciI CCGC 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 1 cut(s) 160
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
AoxI GGCC 1 cut(s) 55
AspS9I GGNCC 1 cut(s) 55
BauI CACGAG 1 cut(s) 15
BciT130I CCWGG 1 cut(s) 82
BciVI GTATCC 1 cut(s) 61
BfuI GTATCC 1 cut(s) 61
Bme1390I CCNGG 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 55
BmrFI CCNGG 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseBI CCWGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 64
BshFI GGCC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 64
BsnI GGCC 1 cut(s) 57
BspACI CCGC 1 cut(s) 98
BspANI GGCC 1 cut(s) 57
BsrBI CCGCTC 1 cut(s) 100
BssSI CACGAG 1 cut(s) 15
Bst2BI CACGAG 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 87
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 80
BsuI GTATCC 1 cut(s) 61
BsuRI GGCC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 55
CseI GACGC 1 cut(s) 47
CviJI RGCY 4 cut(s) 23, 35, 57, 94
CviKI_1 RGCY 4 cut(s) 23, 35, 57, 94
DdeI CTNAG 1 cut(s) 87
EcoRII CCWGG 1 cut(s) 80
FaiI YATR 1 cut(s) 30
HaeIII GGCC 1 cut(s) 57
HgaI GACGC 1 cut(s) 47
Hpy188I TCNGA 2 cut(s) 67, 153
Hpy188III TCNNGA 1 cut(s) 17
Hpy99I CGWCG 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 87
LpnPI CCDG 2 cut(s) 67, 94
MbiI CCGCTC 1 cut(s) 100
MluCI AATT 7 cut(s) 25, 49, 105, 121, 130, 136, 161
MseI TTAA 3 cut(s) 48, 120, 135
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PspPI GGNCC 1 cut(s) 55
SaqAI TTAA 3 cut(s) 48, 120, 135
Sau96I GGNCC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 82
SetI ASST 1 cut(s) 96
SgeI CNNG 4 cut(s) 27, 29, 93, 94
Sse9I AATT 7 cut(s) 25, 49, 105, 121, 130, 136, 161
SsiI CCGC 1 cut(s) 98
StyD4I CCNGG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 126
TasI AATT 7 cut(s) 25, 49, 105, 121, 130, 136, 161
Tru1I TTAA 3 cut(s) 48, 120, 135
Tru9I TTAA 3 cut(s) 48, 120, 135
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.