Rroxscaffold_5G00339000

F-box protein At3g07870-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
7301618 .. 7303403
1786 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00339000.1

Sequence Viewer

Length: 243 bp
ATGCAAGTAACTATGCTTGAATTGTGGCCTTTTTTCAATCAAGAAACAAACAGTTTCAGGGAAGAGTGTATCACTCTGACTTATAATGTGCCACCTGAATCAAGCACTTACAGTCCATCATTTGTTTCACTCTGTGATGTTTCGAAAGGAGAGGAGGTGAAAAGGATTATGTTTCCAGAGGGAAGGGGGCTTGCACCTTTGCGGTCTGTCAACAATGCTTCGACACAGGTTTTCCCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.07

Weight (kDa)

4.73

Isoelectric Point (pI)

66.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000298)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29150 FvH4_1g29150 FvH4_2g35201 FvH4_3g36371 FvH4_4g12590 FvH4_4g12590 FvH4_4g13903 FvH4_4g16630 FvH4_4g16630 FvH4_4g16640 FvH4_4g16640 FvH4_4g16640
malus_domestica MD03G1174100.v1.1 MD13G1177900.v1.1 MD13G1178000.v1.1 MD13G1178100.v1.1
prunus_persica Prupe.1G146800_v2.0.a1 Prupe.1G146900_v2.0.a1 Prupe.1G147000_v2.0.a1 Prupe.1G147100_v2.0.a1 Prupe.1G147200_v2.0.a1 Prupe.1G185600_v2.0.a1 Prupe.1G529300_v2.0.a1 Prupe.6G154200_v2.0.a1 Prupe.6G217100_v2.0.a1
pyrus_communis pycom03g13170 pycom03g13180 pycom05g29500 pycom13g15350 pycom13g15380 pycom13g15390 pycom13g15400
rosa_chinensis RchiOBHm_Chr4g0395601 RchiOBHm_Chr4g0395611 RchiOBHm_Chr4g0395621 RchiOBHm_Chr4g0413281 RchiOBHm_Chr4g0419621 RchiOBHm_Chr4g0419631 RchiOBHm_Chr4g0419901 RchiOBHm_Chr4g0419911 RchiOBHm_Chr4g0419981 RchiOBHm_Chr4g0420081 RchiOBHm_Chr4g0420091 RchiOBHm_Chr6g0306731
rosa_laevigata RLG00000006686 RLG00000007789 RLG00000007793 RLG00000007794 RLG00000007808 RLG00000007809 RLG00000011318
rosa_multiflora Rmu_co8471007.1_g000001 Rmu_sc0000717.1_g000001 Rmu_sc0003141.1_g000001 Rmu_sc0006133.1_g000013 Rmu_sc0013209.1_g000001 Rmu_sc0013209.1_g000002 Rmu_sc0017785.1_g000004 Rmu_sc0017786.1_g000003 Rmu_sc0023895.1_g000004 Rmu_sc0032897.1_g000004
rosa_roxburghii Rroxscaffold_5G00339000 Rroxscaffold_5G00357390 Rroxscaffold_5G00362460 Rroxscaffold_5G00362470 Rroxscaffold_5G00362730 Rroxscaffold_5G00362740 Rroxscaffold_5G00362800
rosa_rugosa Rorug04G0158700 Rorug04G0158800 Rorug04G0158800 Rorug04G0158900 Rorug04G0159000 Rorug04G0159100 Rorug04G0159200 Rorug04G0159300 Rorug04G0161200 Rorug04G0161300 Rorug04G0161300 Rorug04G0161400 Rorug04G0162000 Rorug04G0162100
rosa_samantha Rh1BG049900 Rh4AG179100 Rh4AG179200 Rh4AG220700 Rh4AG222300 Rh4AG222400 Rh4AG222700 Rh4AG222900 Rh4BG222400 Rh4BG222600 Rh4BG224700 Rh4BG224800 Rh4BG225300 Rh4BG225400 Rh4BG338700 Rh4BG338800 Rh4CG235500 Rh4DG174300 Rh4DG219400 Rh4DG219600 Rh4DG221300 Rh4DG221400 Rh4DG221700 Rh5CG465500 Rh5DG455700 Rh6BG417700 Rh6BG436500 Rh6BG436600 Rh6CG478500 Rh6CG478600 Rh6DG465600 Rh6DG465700 Rh6DG492000
rosa_wichuraiana Rw4G018980 Rw4G019160 Rw4G019170 Rw4G019190 Rw4G028680 Rw5G040160 Rw6G040460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 84
AciI CCGC 1 cut(s) 202
AdeI CACNNNGTG 1 cut(s) 134
AgsI TTSAA 2 cut(s) 20, 37
AluBI AGCT 1 cut(s) 240
AluI AGCT 1 cut(s) 240
AoxI GGCC 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 169
AsuII TTCGAA 1 cut(s) 143
BccI CCATC 1 cut(s) 124
BfaI CTAG 2 cut(s) 237, 241
Bpu14I TTCGAA 1 cut(s) 143
BsaXI ACNNNNNCTCC 2 cut(s) 141, 171
BseRI GAGGAG 1 cut(s) 167
BshFI GGCC 1 cut(s) 28
BsnI GGCC 1 cut(s) 28
Bsp119I TTCGAA 1 cut(s) 143
BspACI CCGC 1 cut(s) 202
BspANI GGCC 1 cut(s) 28
BspT104I TTCGAA 1 cut(s) 143
Bst4CI ACNGT 2 cut(s) 53, 113
Bst6I CTCTTC 1 cut(s) 57
BstBI TTCGAA 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 192
BsuRI GGCC 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 192
CviJI RGCY 3 cut(s) 28, 190, 240
CviKI_1 RGCY 3 cut(s) 28, 190, 240
DraIII CACNNNGTG 1 cut(s) 134
Eam1104I CTCTTC 1 cut(s) 57
EarI CTCTTC 1 cut(s) 57
FaiI YATR 3 cut(s) 14, 84, 170
FspBI CTAG 2 cut(s) 237, 241
HaeIII GGCC 1 cut(s) 28
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HinfI GANTC 1 cut(s) 98
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 2 cut(s) 41, 176
Hpy8I GTNNAC 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 177
HpyCH4III ACNGT 2 cut(s) 53, 113
HpyCH4V TGCA 2 cut(s) 4, 194
LpnPI CCDG 4 cut(s) 43, 108, 189, 212
MaeI CTAG 2 cut(s) 237, 241
MaeIII GTNAC 1 cut(s) 7
MboII GAAGA 1 cut(s) 74
MluCI AATT 1 cut(s) 20
MnlI CCTC 3 cut(s) 145, 148, 172
NspV TTCGAA 1 cut(s) 143
PfeI GAWTC 1 cut(s) 98
PsiI TTATAA 1 cut(s) 84
SetI ASST 5 cut(s) 97, 159, 199, 231, 242
SfuI TTCGAA 1 cut(s) 143
SgeI CNNG 9 cut(s) 17, 29, 53, 70, 107, 114, 188, 203, 239
Sse9I AATT 1 cut(s) 20
SsiI CCGC 1 cut(s) 202
SspMI CTAG 2 cut(s) 237, 241
TaaI ACNGT 2 cut(s) 53, 113
TaqI TCGA 2 cut(s) 143, 221
TasI AATT 1 cut(s) 20
TfiI GAWTC 1 cut(s) 98
XspI CTAG 2 cut(s) 237, 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.