Rmu_co8168012.1_g000001

Plant mobile domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8168012.1
Physical Location & Seq
Reverse (-)
193 .. 633
441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8168012.1_g000001.1.cds

Sequence Viewer

Length: 441 bp
atgaagtcagaaagattggagaaagaggttatgctgagtccgactttggtttggggaagtaaggccaagaggaacattaaatatgtaattgtgagtaatgcaagaagtctagataatgacatggtaagaactattggcaatgaatgggctagcagggttgagagacaggtttcagagcttaaaaatcttgtaagaagctttaaagaatcagacattttgaaatattgtaagaagcataaaaatattgaaactagaagagatggtgactgcgtgaagttatcaggtgaagttcaagatttggcatcttcaactgtggaagaaggttctgttatgaaacaggtttcagagcttaaagctagggttagcaagcttgaaagtttggctgacatgtttcaaacaaacactagtggagcaggtgtgggaacagctaaggaaagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

16.42

Weight (kDa)

9.39

Isoelectric Point (pI)

39.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000264)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G48145 AT1G50745
fragaria_vesca FvH4_3g22280 FvH4_3g22281 FvH4_3g22290 FvH4_3g22300 FvH4_3g22321 FvH4_3g22330 FvH4_3g22330 FvH4_3g22331
rosa_chinensis RchiOBHm_Chr5g0038351 RchiOBHm_Chr5g0038361 RchiOBHm_Chr5g0038371 RchiOBHm_Chr5g0038381 RchiOBHm_Chr5g0038421 RchiOBHm_Chr5g0038451 RchiOBHm_Chr5g0038471 RchiOBHm_Chr5g0038491 RchiOBHm_Chr5g0038561 RchiOBHm_Chr5g0038731 RchiOBHm_Chr5g0038741 RchiOBHm_Chr5g0038771 RchiOBHm_Chr5g0038781 RchiOBHm_Chr5g0038791 RchiOBHm_Chr5g0038801 RchiOBHm_Chr5g0038831
rosa_laevigata RLG00000008815 RLG00000020213 RLG00000033850 RLG00000033864 RLG00000033875
rosa_multiflora Rmu_co8006804.1_g000001 Rmu_co8168012.1_g000001 Rmu_co8236409.1_g000001 Rmu_co8247247.1_g000001 Rmu_co8440391.1_g000001 Rmu_sc0000533.1_g000088 Rmu_sc0003198.1_g000005 Rmu_sc0003198.1_g000006 Rmu_sc0003198.1_g000007 Rmu_sc0003198.1_g000008 Rmu_sc0003198.1_g000013 Rmu_sc0005722.1_g000005 Rmu_sc0005722.1_g000007 Rmu_sc0005722.1_g000012 Rmu_sc0005722.1_g000013 Rmu_sc0005836.1_g000001 Rmu_sc0009149.1_g000006 Rmu_sc0009149.1_g000018 Rmu_sc0009149.1_g000020 Rmu_sc0017397.1_g000004 Rmu_sc0025071.1_g000001 Rmu_sc0032545.1_g000001 Rmu_sc0038346.1_g000001
rosa_roxburghii Rroxscaffold_1G00042150 Rroxscaffold_1G00042180 Rroxscaffold_1G00042230 Rroxscaffold_1G00042240 Rroxscaffold_1G00042260 Rroxscaffold_1G00042320 Rroxscaffold_1G00042330 Rroxscaffold_1G00042350 Rroxscaffold_1G00042360 Rroxscaffold_1G00042370 Rroxscaffold_1G00042400 Rroxscaffold_1G00042430 Rroxscaffold_1G00042440 Rroxscaffold_1G00042510 Rroxscaffold_1G00042580 Rroxscaffold_1G00042620
rosa_rugosa Rorug05G0172200 Rorug05G0172300 Rorug05G0172500 Rorug05G0173100 Rorug05G0173200.1 Rorug05G0173600 Rorug05G0173800 Rorug05G0174000 Rorug05G0174100 Rorug05G0174200 Rorug05G0174200 Rorug05G0174400 Rorug05G0174500 Rorug05G0174600 Rorug05G0174700 Rorug05G0174800
rosa_samantha Rh5AG259600 Rh5AG260200 Rh5AG260600 Rh5AG260800 Rh5AG261300 Rh5AG261400 Rh5AG261500 Rh5AG261700 Rh5AG261900 Rh5BG263600 Rh5BG264200 Rh5BG264500 Rh5BG264800 Rh5BG265100 Rh5BG265200 Rh5BG265500 Rh5BG265600 Rh5BG266000 Rh5CG295900 Rh5CG296700 Rh5CG296800 Rh5CG296900 Rh5CG297200 Rh5CG297700 Rh5CG297900 Rh5CG298100 Rh5CG298200 Rh5CG298300 Rh5CG298400 Rh5CG298500 Rh5CG298900 Rh5CG299200 Rh6DG125700
rosa_wichuraiana Rw0G001950 Rw0G001960 Rw0G013290 Rw5G024020 Rw5G024310 Rw5G024340 Rw5G024350 Rw5G024370 Rw5G024380 Rw5G024390 Rw5G024400 Rw5G024420

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 404
Acc36I ACCTGC 1 cut(s) 404
AflIII ACRYGT 1 cut(s) 387
AgsI TTSAA 6 cut(s) 220, 248, 293, 309, 374, 395
AhlI ACTAGT 1 cut(s) 404
AluBI AGCT 6 cut(s) 178, 198, 349, 356, 370, 428
AluI AGCT 6 cut(s) 178, 198, 349, 356, 370, 428
Alw26I GTCTC 1 cut(s) 157
AoxI GGCC 1 cut(s) 63
AsuHPI GGTGA 2 cut(s) 275, 296
AsuNHI GCTAGC 1 cut(s) 149
BccI CCATC 1 cut(s) 254
BcoDI GTCTC 1 cut(s) 157
BcuI ACTAGT 1 cut(s) 404
BfaI CTAG 5 cut(s) 110, 150, 252, 357, 405
BfuAI ACCTGC 1 cut(s) 404
BmsI GCATC 1 cut(s) 311
BmtI GCTAGC 1 cut(s) 153
Bpu10I CCTNAGC 1 cut(s) 429
BsaXI ACNNNNNCTCC 2 cut(s) 402, 432
Bse3DI GCAATG 1 cut(s) 145
BseMI GCAATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 26
BshFI GGCC 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 157
BsnI GGCC 1 cut(s) 65
BspANI GGCC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 27
BspMI ACCTGC 1 cut(s) 404
BspOI GCTAGC 1 cut(s) 153
BsrDI GCAATG 1 cut(s) 145
Bst4CI ACNGT 1 cut(s) 313
Bst6I CTCTTC 1 cut(s) 250
BstC8I GCNNGC 2 cut(s) 151, 368
BstDEI CTNAG 2 cut(s) 35, 429
BstMAI GTCTC 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 391
BsuRI GGCC 1 cut(s) 65
BveI ACCTGC 1 cut(s) 404
Cac8I GCNNGC 2 cut(s) 151, 368
CviAII CATG 2 cut(s) 121, 388
CviJI RGCY 9 cut(s) 65, 149, 178, 198, 349, 356, 370, 383, 428
CviKI_1 RGCY 9 cut(s) 65, 149, 178, 198, 349, 356, 370, 383, 428
DdeI CTNAG 2 cut(s) 35, 429
DraI TTTAAA 1 cut(s) 202
Eam1104I CTCTTC 1 cut(s) 250
EarI CTCTTC 1 cut(s) 250
FaeI CATG 2 cut(s) 124, 391
FaiI YATR 6 cut(s) 32, 84, 122, 237, 332, 389
FatI CATG 2 cut(s) 120, 387
FspBI CTAG 5 cut(s) 110, 150, 252, 357, 405
HaeIII GGCC 1 cut(s) 65
Hin1II CATG 2 cut(s) 124, 391
HindIII AAGCTT 2 cut(s) 196, 368
HinfI GANTC 2 cut(s) 37, 206
HphI GGTGA 2 cut(s) 275, 296
Hpy188I TCNGA 5 cut(s) 10, 42, 175, 211, 346
Hpy188III TCNNGA 2 cut(s) 110, 293
HpyAV CCTTC 1 cut(s) 314
HpyCH4III ACNGT 1 cut(s) 313
HpyCH4V TGCA 1 cut(s) 101
HpyF3I CTNAG 2 cut(s) 35, 429
Hsp92II CATG 2 cut(s) 124, 391
LmnI GCTCC 1 cut(s) 410
LpnPI CCDG 5 cut(s) 139, 152, 267, 323, 399
LweI GCATC 1 cut(s) 311
MaeI CTAG 5 cut(s) 110, 150, 252, 357, 405
MaeIII GTNAC 1 cut(s) 263
MboII GAAGA 3 cut(s) 267, 297, 329
MluCI AATT 1 cut(s) 87
MlyI GAGTC 1 cut(s) 46
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 2 cut(s) 19, 63
MseI TTAA 4 cut(s) 78, 180, 201, 351
NheI GCTAGC 1 cut(s) 149
NlaIII CATG 2 cut(s) 124, 391
NmuCI GTSAC 1 cut(s) 263
NspI RCATGY 1 cut(s) 391
PaqCI CACCTGC 1 cut(s) 404
PciI ACATGT 1 cut(s) 387
PfeI GAWTC 1 cut(s) 206
PleI GAGTC 1 cut(s) 45
PpsI GAGTC 1 cut(s) 45
PscI ACATGT 1 cut(s) 387
SaqAI TTAA 4 cut(s) 78, 180, 201, 351
SchI GAGTC 1 cut(s) 46
SfaNI GCATC 1 cut(s) 311
SpeI ACTAGT 1 cut(s) 404
Sse9I AATT 1 cut(s) 87
SspI AATATT 2 cut(s) 224, 244
SspMI CTAG 5 cut(s) 110, 150, 252, 357, 405
TaaI ACNGT 1 cut(s) 313
TasI AATT 1 cut(s) 87
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 4 cut(s) 78, 180, 201, 351
Tru9I TTAA 4 cut(s) 78, 180, 201, 351
TseFI GTSAC 1 cut(s) 263
Tsp45I GTSAC 1 cut(s) 263
TspDTI ATGAA 3 cut(s) 17, 156, 347
XbaI TCTAGA 1 cut(s) 109
XceI RCATGY 1 cut(s) 391
XspI CTAG 5 cut(s) 110, 150, 252, 357, 405
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.